Generated by All in One SEO Pro v5.0.0.1, this is an llms.txt file, used by LLMs to index the site. # SchoolWorkHelper Your online site for school work help and homework help. Science, English, History, Civics, Art, Business, Law, Geography, all free! ## Sitemaps - [XML Sitemap](https://schoolworkhelper.net/sitemap.xml): Contains all public & indexable URLs for this website. ## Posts - [The Story of Moses](https://schoolworkhelper.net/the-story-of-moses/) - Moses was born a Hebrew at the time when Hebrews were slaves in Egypt All Hebrew baby boys were sentenced to be killed at birth for the Egyptian leaders feared an uprising within the Hebrew slaves to avoid losing her child, Moses’ mother placed him in a basket and sent him down the Nile River - [Flannery O'Connor's A Good Man is Hard to Find: Summary & Analysis](https://schoolworkhelper.net/flannery-oconnors-a-good-man-is-hard-to-find-summary-analysis-2/) - In A Good Man is Hard to Find, the story begins with the characters planning a family trip to Florida. However, the unnamed Grandmother, the matriarch, disagrees with the rest of the family as she would instead go to Tennessee. The Grandmother mentions a dangerous individual, the Misfit, to make her case against going to - [Differences in Radio AM and FM](https://schoolworkhelper.net/differences-in-radio-am-and-fm/) - In modern society, radio is the most widely used medium of broadcasting and electronic communication: it plays a major role in many areas such as public safety, industrial manufacturing, processing, agriculture, transportation, entertainment, national defense, space travel, overseas communication, news reporting, and weather forecasting. In radio broadcasts, they use radio waves which can be both - [4 Reasons Why Learning Spanish is Good for Students](https://schoolworkhelper.net/4-reasons-why-learning-spanish-is-good-for-students/) - The world is now a global village, thanks to technology, and people from various countries, cultures, and backgrounds easily meet for business, job opportunities, or while on holiday. The major challenge many face while trying to blend into the modern world is the language barrier. It can be challenging to maximize your opportunities unless you - [500 Days of Summer: Musical Scene Analysis](https://schoolworkhelper.net/500-days-of-summer-musical-scene-analysis/) - Marc Webb’s 2009 film (500) Days of Summer tells the story of Tom (Joseph Gordon-Levitt), someone who genuinely believes in true love and his time with Summer (Zooey Deschanel), someone who doubts its existence. Webb frequently uses codes and conventions develop Tom and Summer’s characters and background, throughout the musical scene, mise en scene, acting - [Effect of Salt Concentration on Osmosis in Potato Cells Lab Answers](https://schoolworkhelper.net/effect-of-salt-concentration-on-osmosis-in-potato-cells-lab-answers/) - INTRODUCTION The cell membrane surrounds the cell and is responsible for regulating substances within the cell. There are many processes in which substances can travel through the membrane, one being osmosis. Osmosis is a form of passive transport (no energy required) and is a type of diffusion in liquid substances. It is the transport of - [Lab Explained: Ohm's Law Lab](https://schoolworkhelper.net/lab-explained-ohms-law-lab/) - Research question: How will increasing the voltage (v) to 5v, 10v, 20v, 35v, and then 50v affect the amount of current (Amps) measured by an ammeter, keeping the resistance (ohms) at 12 ohms and the wire length of 10cm constant, in a series circuit to prove ohms law? Background information on Ohm's law: Ohm’s law - [A Doll’s House: Nora Helmer Character Analysis](https://schoolworkhelper.net/a-dolls-house-nora-helmer-character-analysis/) - Nora Helmer, the main protagonist of A Doll’s House characters, is the wife of Torvald and a mother of three children. She lives like a doll in a doll-house, and her character serves as a symbol for every oppressed woman who is restricted from living a free life. In the beginning of the play, Nora - [Kinetics Lab Explained: Iodination of Acetone](https://schoolworkhelper.net/kinetics-lab-explained-iodination-of-acetone/) - Introduction: Iodination of Acetone Lab Report Kinetics in chemistry deals with the rate at which a chemical reaction occurs. This rate, which is referred to as the reaction rate, is defined as the change in concentration of a reactant or product with time and is measured in M/s. The rate of a reaction is proportional - [“On the Sidewalk, Bleeding”: Analysis & Theme](https://schoolworkhelper.net/on-the-sidewalk-bleeding-analysis-theme/) - On the Sidewalk Bleeding Summary There are three narrative elements to the short story, “On the Sidewalk Bleeding.” The ones that will be discussed are conflict, theme, and setting. “On the Sidewalk Bleeding” has two different kinds of conflict. First, there is a man vs. man conflict. In the beginning of the story, Andy is - [Importance of Literature: Essay](https://schoolworkhelper.net/importance-of-literature-essay/) - What is Literature Essay What is the Importance of Literature? Literature is the foundation of life. It places an emphasis on many topics from human tragedies to tales of the ever-popular search for love. While it is physically written in words, these words come alive in the imagination of the mind, and its ability to - [Islamic Festivals List](https://schoolworkhelper.net/islamic-festivals/) - Importance of Islamic Festivals Islamic Muslim festivals play a significant role in the lives of Muslims, providing spiritual enrichment and opportunities for communal celebration. Here is an overview of some key Muslim festivals and their importance: The Ramadan Fast One of the most important Islamic festivals, the Ramadan Fast, is celebrated in the month of - [Titration of Vinegar Lab Report: Sodium Hydroxide and Vinegar](https://schoolworkhelper.net/titration-of-vinegar-lab-answers/) - Introduction Vinegar is a common household item containing acetic acid as well as some other chemicals. This experiment is designed to determine the molar concentration of acetic acid in a sample of vinegar by titrating it with a standard solution of NaOH. CH3COOH(aq) + NaOH(aq) -> CH3COONa(aq) + H2O(l) By adding sodium hydroxide, which is - [Selective Permeability of Dialysis Tubing Lab: Explained](https://schoolworkhelper.net/selective-permeability-of-dialysis-tubing-lab-explained/) - ABSTRACT: This dialysis tube experiment experiment was conducted to investigate the selective permeability of dialysis tubing. The permeability of the tubing to glucose, starch, and iodine (potassium iodide) was tested. The dialysis tubing was clipped to form a bag so that glucose and starch were fed into the bag through the other end, and was - [The Portrayal of Women in An Inspector Calls](https://schoolworkhelper.net/the-exploitation-of-women-in-an-inspector-calls/) - How Are Women Presented in An Inspector Calls? In An Inspector Calls, J. B. Priestley highlights socialist ideas and ideals through the representation and treatment of women in the play. The upper-class women within 1912 society are shown to be respected and wealthy, but obedient to their husbands. However, the women of the lower classes - [Shakespeare's Othello: Black Ram Imagery](https://schoolworkhelper.net/relationships-in-shakespeares-othello/) - Throughout history, relationships have been the focal point of a myriad of literature, mainly focusing upon both the highs and lows of them. Shakespeare especially focuses on relationships in much of his work, ranging from “Romeo and Juliet” to “Othello.” All writers use this theme to convey the fundamentality of relationships within life and the - [Why Did Eve Eat the Apple?](https://schoolworkhelper.net/why-did-eve-eat-the-apple/) - No one completely understands the ways of God. Many of us can come up with our own opinions and justify his ways in our own minds, just as Milton did in Paradise Lost. Just as Adam and Eve, we all are gifted with free will and the responsibility of making important decisions and choices in - [Thermal Energy Transfer: Conduction, Convection, Radiation](https://schoolworkhelper.net/thermal-energy-transfer-conduction-convection-radiation/) - All things are made up of molecules. When things get heated, they absorb heat energy. With more energy, molecules are able to move faster, and when molecules move faster, the temperature rises. What is Thermal Energy Transfer Thermal Energy is energy resulting from the motion of particles It is a form of kinetic energy and - [Vehicle Systems & Overview](https://schoolworkhelper.net/vehicle-systems-overview/) - The modern vehicle is made up of a variety of parts and components all working together to achieve a final product: the “car.” These parts and components are assembled in groups to perform various tasks. These groups are referred to as systems. Understanding these automotive systems is crucial for anyone interested in car maintenance and - [Alice Munro's "Boys and Girls": Summary & Analysis](https://schoolworkhelper.net/alice-munros-boys-and-girls-summary-analysis/) - Boys and Girls by Alice Munro Summary Alice Munro’s short story, “Boys and Girls,” has a very interesting detail written into it. The narrator’s brother is named Laird, which was carefully chosen by the author. Laird is a synonym for lord, which plays an important role in a story where a young girl has society’s - [Death of a Salesman: Willy Loman Character Analysis](https://schoolworkhelper.net/death-of-a-salesman-willy-loman-character-analysis/) - Willy in Death of a Salesman In Arthur Miller's "Death of a Salesman," Willy Loman emerges as a complex character driven by insecurity and dissatisfaction. As the protagonist, Willy's struggles and flaws are meticulously depicted, making him one of the most poignant characters in American theater. His life, spoiled by unfulfilled dreams and constant craving - [Automobiles in 1920s: History & Production](https://schoolworkhelper.net/automobiles-in-1920s-history-production/) - One of the most notable signs of ‘prosperity’ in the 1920s was the growth of the automobile industry. The vision of Henry Ford to create an affordable car for the masses became a reality with the rise of innovative production techniques. The Rise of the Automobile Industry Henry Ford revolutionized the automobile industry in the - [Ticker Tape Lab Answers](https://schoolworkhelper.net/ticker-tape-lab-answers/) - Introduction In physics, any increase or decrease in velocity is referred to as acceleration or deceleration. The rate of acceleration is measured in m/s² or km/m/s respectively. The average acceleration of an object can be derived from the formula. This experiment, commonly known as the ticker timer experiment, involves analyzing the motion of a cart - [Numerology: Lucky & Unlucky Numbers](https://schoolworkhelper.net/numerology-lucky-unlucky-numbers/) - Numerology: Understanding Lucky and Unlucky Numbers Numerology is the study of the mystical relationship between numbers and events or characteristics in the world. Throughout history, various civilizations have attributed special significance to certain numbers, considering some as lucky numbers and others as unlucky numbers. This fascinating field explores how numbers can influence our lives, beliefs, - [TECHNICAL DRAWING & ALPHABET OF LINE](https://schoolworkhelper.net/technical-drawing-alphabet-of-line/) - Technical drawings are crucial in conveying how an object should be manufactured or constructed. These drawings use standardized line symbols, known as the "alphabet of lines," to communicate detailed and precise information universally understood. The accuracy and clarity provided by technical drawings ensure that anyone, regardless of language, can understand/read the specifications necessary to build - [Lab Explained: The Relationship Between Centripetal Force, Mass and Speed](https://schoolworkhelper.net/lab-explained-the-relationship-between-centripetal-force-mass-and-speed/) - Objective: The purpose of this lab is to investigate the relationship between the speed of an object in uniform circular motion (UCM) and the centripetal force (FC) on it. This direct correlation will be calculated by determining our values for how long it may take for any given weight to undergo 20 cycles. Using this - [Lab Explained: Properties of the Ionic Compounds](https://schoolworkhelper.net/lab-explained-properties-of-the-ionic-compounds/) - Research Question: What are some of the properties of ionic compounds? Background: Ionic compounds are formed from a crystal lattice, a cation ionically bonded with anion in an alternating three-dimensional pattern, whose bond strength determines the compound's properties. Ionic crystals have high melting and boiling points. They conduct electricity when dissolved in water or melted. - [Lab Answers: Concentration of Salt Solution Affects the Change in Mass of a Cylinder of Potato?](https://schoolworkhelper.net/lab-answers-concentration-of-salt-solution-affects-the-change-in-mass-of-a-cylinder-of-potato/) - Background Osmosis is the movement of water molecules from a high-concentration region to a low-concentration region (Guyton and Hall, 2021). Only the free water molecules in the solution can move; the solute molecules remain stationary (Raven, Johnson, and Mason, 2014). Osmosis continues until the concentration of water molecules on either side of the membrane reaches - [Romeo and Juliet: Fate vs. Free Will](https://schoolworkhelper.net/romeo-and-juliet-fate-vs-free-will-2/) - The idea of destiny has been connected to the notion of stars, which some believe control human life. This gives rise to the idea of “star-crossed” lovers—those for whom a sorrowful fate seems inevitable. In the play Romeo and Juliet, the characters suffer a tragic ending: death. However, many argue that it is not destiny - [Aporias by Jacques Derrida: Analysis](https://schoolworkhelper.net/aporias-by-jacques-derrida-analysis/) - Throughout his works, the postmodern thinker Jaques Derrida explores a variety of thoughts around a wide variety of topics. While all writings present new understandings applicable not just in theory but in daily life, some of his writings most grounded in daily human experience are those he presents around his aporias, or puzzlements. Within these - [Foucault’s analysis of Hobbes](https://schoolworkhelper.net/foucaults-analysis-of-hobbes/) - When describing the state of nature, Hobbes famously describes a state of war which is “nasty, brutish and short.” It is understood by Hobbes to be a state of constant fighting between all members of society- a constant war between everyone. However, in Foucault’s reading of Hobbes, he critiques this conception of the state of - [Foucault's Discipline and Punish: Analysis](https://schoolworkhelper.net/foucaults-discipline-and-punish-analysis/) - The “docile body” as conceived by Foucault is a person who, as a result of disciplinary power is molded into someone who does exactly what they are supposed to in exactly the way they are supposed to. This concept of a docile, malleable, body is applied originally to that of soldiers, where Foucault describes training - [Religious Victimization of Shylock in The Merchant of Venice](https://schoolworkhelper.net/religious-victimization-of-skylock-in-the-merchant-of-venice/) - William Shakespeare is often referred to as the greatest Scriptwriter ever. He truly has a skill, of creating unique characters that, create controversy, and give reasons for people to discuss and debate. Back in the Elizabethan times, Shylock, a character, from the famous Shakespearean play, The Merchant of Venice, would have immediately been seen as - [The Implications of The Prisoner’s Dilemma](https://schoolworkhelper.net/the-implications-of-the-prisoners-dilemma/) - The ‘prisoner’s dilemma’ is a hypothetical situation often used in the context of Hobbes’ Social Contract Theory. It is a seemingly simple situation which carries significant implications which add to the understanding of Hobbes' conception of the state of nature as a “‘solitary, poor, nasty, brutish, and short’” (Rachels, 2012, p. 83) state of war, - [Ammonium Chloride (NH4CL) Solubility: Lab Explained](https://schoolworkhelper.net/ammonium-chloride-nh4cl-solubility-lab-explained/) - Model 1: What impact does temperature have on NH4CL solubility in water? Model 2: How will changing the limiting reactant impact the procedure's outcome? Model 3: How does the number of intermediates involved in the reaction affect the accuracy of Hess's Law's prediction of the enthalpy change of a chemical reaction? Introduction Three different experiments - [Dialogue and Symbolism in John Lewis’ March: Book One](https://schoolworkhelper.net/dialogue-and-symbolism-in-john-lewis-march-book-one/) - Comics tend to garner a bad reputation among casual readers because of a misconception that comics are only ever about light and playful topics. The use of drawings and illustrations, especially those in a traditional “cartoony” style, also veers away from those looking for a more serious topic to read. However, the Graphic Novel trilogy - [Victimization of Ophelia in Shakespeare's Hamlet](https://schoolworkhelper.net/victimization-of-ophelia-in-shakespeares-hamlet/) - Hamlet, a world-famous play by William Shakespeare, is a very dark and somber piece of work. With murders and lies almost seeming to be a common topic throughout the play, it would be an understatement to say only Hamlet was the true victim in this theatrical work. Characters like Horatio, who did not provoke anyone - [Investigating the Properties of Concave and Convex Lenses: Lab Report Asnwers](https://schoolworkhelper.net/investigating-the-properties-of-concave-and-convex-lenses-lab-report-asnwers/) - PURPOSE The purpose of the experiment is to validate the lens equation and the magnification equation by measuring the image distance from a fixed focal length and the object distance from the thin lens using concave and convex lenses. QUESTION How does an object's image position and size (magnification) vary with different object distances from - ["Common Sense" by Thomas Paine Analysis](https://schoolworkhelper.net/common-sense-by-thomas-paine-analysis/) - On July 4th 1776, the Declaration of Independence was adopted by the Continental Congress, the document undoubtedly influenced by the work of Thomas Paine, if not written by him like some historians theorize. A few months before in January 1776, the pamphlet Common Sense was published by Thomas Paine during the American revolution and was - [Catalase Enzyme Activity Lab: Answers](https://schoolworkhelper.net/catalase-enzyme-activity-lab-answers/) - Foreword This laboratory involves the use of an enzyme that will react with hydrogen peroxide. The enzyme is catalase, and the substrate is hydrogen peroxide (H2O2). The reaction is as follows: catalase 2H2O2 2H2O + O2 Ingested hydrogen peroxide is a poison, while external use of this substance is not. However, the generation of oxygen - [Permeability of the Beetroot Membrane: Lab Answers](https://schoolworkhelper.net/permeability-of-the-beetroot-membrane-lab-answers/) - Permeability of a cell to solutes in an aqueous solution depends upon the physical and chemical make-up of the membrane. The maintenance of the living cell depends upon the continued presence and functioning of a selectively permeable membrane. If the nature of the membrane is altered in any way, this may affect it’s permeability and - [The Shawnee Tribe & War of 1812](https://schoolworkhelper.net/the-shawnee-tribe-war-of-1812/) - The Shawnee - Originated from Ohio Valley- Name means Southerners- Villages in South Carolina, Tennessee, Penny, Georgia, Alabama, Ohio- Roving people, practiced agriculture in villages- Spoke Algonquin dialect- Relied on the woods in their culture and habits The Shawnee - Overview and Contributions to the War Effort - A First Nations tribe which felt great - [Billy Elliot: Movie Analysis](https://schoolworkhelper.net/billy-elliot-movie-analysis/) - 1) Family: For the most part, Billy’s family was completely unsupportive of his life choice. Set in the fictional town of Everington during the UK miners' strike (1984–1985), both Billy’s father and old brother are preoccupied with the strike and causing “justified” mayhem. His grandma lives with the family, however, she is more of a - [Ancient Roman Law](https://schoolworkhelper.net/ancient-roman-law/) - Heavily influenced the idea of punishing crimes Roman law has influenced the national legal systems not only in Europe but also in America, Africa, and Asia Roman Law is the stable foundation upon which modern legal culture has developed and evolved as a whole. The Senate Made most of the laws in the Roman Republic - [Single Displacement Reactions and the Activity Series of Metals: Lab Explained](https://schoolworkhelper.net/single-displacement-reactions-and-the-activity-series-of-metals-lab-explained/) - Introduction Every day substances are constantly being altered in some way. These altercations can be classified as physical or chemical changes. Physical changes are altercations in which the chemical composition of a substance remains constant. A common example is the change in the state of matter of dihydrogen monoxide (water - H2O). Its physical properties - [Simple Harmonic Motion Lab: Explained & Answers](https://schoolworkhelper.net/simple-harmonic-motion-lab-explained-answers/) - PURPOSE The purpose of this lab is to quantitatively investigate how the mass of a coil spring and the length of a pendulum affect the period of oscillation of a system experiencing simple harmonic motion. In this lab, I will establish a mathematical connection between the period and these variables through the execution of this - [Isotopes of Pennium Lab: Explained & Answers](https://schoolworkhelper.net/isotopes-of-pennium-lab-explained-answers/) - Introduction: Unless you’re a coin collector, you probably think all United States pennies are pretty much the same. To the casual observer, all the pennies in circulation do seem to be identical in size, thickness, and composition. But just as elements have one or more isotopes with different masses, the pennies in circulation have different - [Percent Composition Lab Explained & Answers](https://schoolworkhelper.net/percent-composition-lab-explained-answers/) - In this experiment, you will determine the mass percent of carbon produced in the decomposition of sodium bicarbonate produced from the following chemical equation: Reacting sodium bicarbonate (sodium hydrogen carbonate) with sulfuric acid will produce a salt, water, and carbon dioxide gas. According to the Law of Definite Composition, the mass percentage of carbon produced - [Specific Heat Capacity Lab Explained & Answers](https://schoolworkhelper.net/specific-heat-capacity-lab-explained-answers/) - Purpose: To find the specific heat capacity of a substance Principle: According to the principle of thermal energy exchange, when thermal energy is transferred from a warmer object to a colder object, the amount of thermal energy released by the warmer object is equal to the amount of thermal energy absorbed by the colder object. - [Determining Heat Capacity of Water Lab Answers](https://schoolworkhelper.net/determining-heat-capacity-of-water-lab-answers/) - Introduction In this experiment you will measure the heat capacity of water using an electrical immersion heater. Prediction Throughout this experiment, we predict that the change in temperature compared to the amount of heat added to the water will be constant thus making it proportional. Materials Power supply Immersion heater Connecting wire Thermometer Calorimeter Balance - [Total Internal Reflection Lab: Explained & Answers](https://schoolworkhelper.net/total-internal-reflection-lab-explained-answers/) - Comparing the refractive index of a medium with its critical angle PURPOSE This lab was conducted to prove a relationship between the critical angle and index of refraction of a ray of light passing through a denser medium to air. QUESTION How does the critical angle vary across media with different refractive indices? BACKGROUND KNOWLEDGE - [Analysis of Chapters 1-2: Lord of the Flies](https://schoolworkhelper.net/analysis-of-chapters-1-2-lord-of-the-flies/) - Key Plot Points: A boy named Ralph, met another boy called Piggy; they realized that the plane they were on had been attacked and now they were lost on an island. Ralph had found a conch, which he then blew to call all of the children since they were all spread out across the island. - [Projectile Motion Lab: Explained & Answers](https://schoolworkhelper.net/projectile-motion-lab-explained-answers/) - Purpose To understand the nature of projectile motion launched horizontally as well as launched at an angle. Introduction In horizontally launched projectiles, vertical velocity Vy is zero and g is 9.8 m/s2. If we know the vertical height of the launching position d, we can calculate time of flight using the equation d = Vyt - [Colin Kaepernick Nike Ad Controversy: Essay](https://schoolworkhelper.net/colin-kaepernick-nike-ad-controversy-essay/) - Companies all over the world have a goal to strive and make money. However, is making money the main objective for these companies or do they honestly want to influence society in a positive way? In 2016, Colin Kaepernick, the famous NFL quarterback, refused to stand up for the U.S. national anthem to protest against - [Conservation of Mass Lab: Explained & Answers](https://schoolworkhelper.net/conservation-of-mass-lab-explained-answers/) - Abstract: The Law of Conservation of Mass is an important principle to the scientific community and the world of chemistry. The objective of this lab was to verify if this law holds true. This law is beneficial in chemistry as it allows us to predict the final products of a chemical reaction. In this lab, - [Enzyme pH Lab: Testing Catalase Lab Answers](https://schoolworkhelper.net/enzyme-ph-lab-testing-catalase-lab-answers/) - Introduction Catalysis is the acceleration of a chemical reaction by a substance called a catalyst. Enzymes increase the reaction rate, causing the reaction to make more product. Proteins are large, complex molecules composed of chains of amino acids. The three-dimensional structure of a protein is critical to its function, as it determines how the protein - [Effects of Temperature and pH on Cell Permeability & Effects of Substrate Concentration on Enzymes in Proteins Lab Answers](https://schoolworkhelper.net/effects-of-temperature-and-ph-on-cell-permeability-effects-of-substrate-concentration-on-enzymes-in-proteins-lab-answers/) - Abstract Proteins are very complex structures and have many variables that affect their function. This lab examined some of those variables. For the first part beef liver, which contains the enzyme catalase, was added to solutions of different concentrations of the substrate hydrogen peroxide. The second and third sections tested the effects of temperature and - [Factors Affecting the Activity of Catalase and Amylase Lab Answers](https://schoolworkhelper.net/factors-affecting-the-activity-of-catalase-and-amylase-lab-answers/) - Introduction Proteins (or polypeptides) are organic macromolecules consisting of amino acid subunits (monomers) that are arranged in a specific order and folded into a specific shape. These monomers of amino acids are arranged in a specific sequence known as the primary structure which is determined by the DNA of the gene coding that protein. Amino - [The Failure of the Justice System in "A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood"](https://schoolworkhelper.net/the-failure-of-the-justice-system-in-a-true-story-of-murder-family-secrets-and-the-unbreakable-bond-of-sisterhood/) - In a world where justice should prevail, the cracks in the system have grown into gaping chasms, exposing a disheartening truth: the failure of the justice system. In Gregg Olsen's true crime novel, A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood, the theme of the justice system's failure is poignantly - [Shattered Bonds: Unveiling the Struggle and Resilience in "A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood”](https://schoolworkhelper.net/shattered-bonds-unveiling-the-struggle-and-resilience-in-a-true-story-of-murder-family-secrets-and-the-unbreakable-bond-of-sisterhood/) - Within the intricate labyrinth of human connections lies an intangible thread that unifies everyone—the bonds everyone has. However, when confronted with adversity and turmoil, these very bonds possess the potential to fracture, exposing the delicate nature of our existence and the unyielding fortitude harbored within the human spirit. In, A True Story of Murder, Family - [A Haunting Portrait of Society's Shadows: Unveiling Cultural Reflections in "A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood"](https://schoolworkhelper.net/a-haunting-portrait-of-societys-shadows-unveiling-cultural-reflections-in-a-true-story-of-murder-family-secrets-and-the-unbreakable-bond-of-sisterhood/) - In the dimly lit corners of society, where truths often remain obscured, lies a haunting portrait reflecting culture's collective essence. Through its brushstrokes of intricacy and nuance, this portrayal unveils the hidden shadows that shape and define societal landscape, offering a sobering glimpse into the intricate tapestry of shared human experiences. The publication of A - ["A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood": Nikki Character Analysis](https://schoolworkhelper.net/a-true-story-of-murder-family-secrets-and-the-unbreakable-bond-of-sisterhood-nikki-character-analysis/) - The character development of individuals is akin to peeling back the intricate layers of a resilient spirit, exposing the remarkable strength, growth, and transformation that can emerge from the crucible of life's challenges. In A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood, by Gregg Olsen, one character who undergoes a - [If You Tell: A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood- The Interplay of Storytelling and Nonfiction](https://schoolworkhelper.net/if-you-tell-a-true-story-of-murder-family-secrets-and-the-unbreakable-bond-of-sisterhood-the-interplay-of-storytelling-and-nonfiction/) - In a dance as old as time, where imagination meets truth, the interplay of storytelling and nonfiction creates a captivating symphony of knowledge, blurring the lines between reality and the power of narrative. Gregg Olsen's true crime novel, A True Story of Murder, Family Secrets, and the Unbreakable Bond of Sisterhood, masterfully combines storytelling techniques - [Trigonometry Tree Height: Solution](https://schoolworkhelper.net/trigonometry-tree-height-solution/) - Method A: Clinometer Measurements and Calculations: Procedure 1. Choose a tree and stand at a distance away from the tree where the top of the tree can be seen 2. Direct Clinometer towards the top of the Tree from the height of the eye 3. Record the angle observed while staying stationary from the - [Percent Yield Lab: Explained & Solutions](https://schoolworkhelper.net/percent-yield-lab-explained-solutions/) - Data Table Material Mass (g) Empty labelled beaker 108.43g Copper (II) chloride dihydrate; CuCl2 · 2H2O 4.98g Iron (steel wool); Fe (s) 1.02g Beaker containing clean, dry copper 110.02g Analysis a. Identify the precipitate that was formed in the reaction : Fe (s) + CuCl2 (aq) → Cu (s) + - [Diffusion, Osmosis & Water Potential Lab: Explained](https://schoolworkhelper.net/diffusion-osmosis-water-potential-lab-explained/) - Purpose: To critically explore how osmosis occurs within a semi-permeable membrane with a variety of concentrations of sugar solutions. Hypothesis: If the 20% concentrated sucrose solution is placed in distilled water, then the weight of the dialysis bag will increase because the fluid within the dialysis bag is hypertonic to the environment. Thus, they will - [Canada’s Primary Industries: Oil Seeds](https://schoolworkhelper.net/canadas-primary-industries-oil-seeds/) - Raw Material: Oilseeds Primary Industry: Agriculture Where Oilseeds Can Be Found in Canada (Geographic Location): Oilseeds are grown in various regions across Canada. Some of the places where oilseed production includes the Prairie provinces of Alberta, Saskatchewan, and Manitoba, along with Ontario and Quebec. Prairie Provinces (Alberta, Saskatchewan, Manitoba): The Prairie provinces, also known as - [Organic Reactions Polymer: Lab Explained](https://schoolworkhelper.net/organic-reactions-polymer-lab-explained/) - INTRODUCTION Sodium polymethacrylate is an example of a condensation polymer. On its own, it is tightly wound and appears like a granule of sugar. The monomer of sodium polymethacrylate is shown below. When water is added, the polymethacrylate will absorb the water through osmosis. As a result, hydrogen bonds with the oxygen in water. As - [Hess’ Law Lab Explained & Answers](https://schoolworkhelper.net/hess-law-lab-explained-answers/) - Introduction This lab is an experiment involving thermodynamics that aims to determine the enthalpy change of a chemical reaction through calorimetry. Enthalpy is a thermodynamic quantity that is related to the amount of heat released or absorbed during a chemical reaction. Hess's law is based on the principle that the enthalpy change of a chemical - [Redox Titration Lab: Explained](https://schoolworkhelper.net/redox-titration-lab-explained/) - Purpose: To calculate the percentage of H2O2 in a bottle of drugstore hydrogen peroxide by titrating with a standardized potassium permanganate solution. Background: Hydrogen peroxide, H2O2, is easily oxidized. It is used in commercial bleaching processes and wastewater treatment plants as an environmentally friendly alternative to chlorine. Dilute solutions of H2O2 are used to bleach - [Ester Lab: Explained and Answers](https://schoolworkhelper.net/ester-lab-explained-and-answers/) - Methyl salicylate C6H4 (HO) COOCH3, also known as salicylic acid methyl ester, oil of wintergreen, is a natural product of many species of plants. Methyl salicylate may be used by plants as a pheromone to warn other plants of pathogens such as tobacco mosaic virus. Methyl salicylate is used in deep heating liniments and in - [Hess’ Law & Calorimetry Lab: Explained](https://schoolworkhelper.net/hess-law-calorimetry-lab-explained/) - Hess’s Law is an advantageous concept in thermodynamics which states that regardless of the multiple steps or stages in a reaction, the total enthalpy change for a reaction will always be the total sum of all enthalpy changes. The heat created during a combustion reaction is measured by the enthalpy of combustion per mole of - [Advantages and Challenges of Nuclear Energy](https://schoolworkhelper.net/advantages-and-challenges-of-nuclear-energy/) - Former US President, Barack Obama once said, “We are the first generation to feel the effect of climate change and the last generation who can do something about it.” Since the 19th century, the average global temperature has risen by over 2 degrees Fahrenheit. This number seems small but in reality, this increase in temperature - [Effects of Warfare on Technological Development](https://schoolworkhelper.net/effects-of-warfare-on-technological-development/) - History is described as the change of events over time, but in history, there are constants, and one such constant is war. As said by Greg Bradenn, “War is not human nature. It is a habit”.[1]Throughout history, war has ingrained itself in the human mind. Conflict and battle, occurring in repetitive cycles throughout history as - [Polymer Lab: Explained and Answers](https://schoolworkhelper.net/polymer-lab-explained-and-answers/) - Cornstarch: Upon adding 2 mL of cornstarch to the mixture, a visible change was observed. The mixture exhibited a significant increase in volume and took on a snow-like appearance, becoming more puffy. Stirring the mixture with a stirring rod gradually transformed the mixture's color into a clear opaque white. Sugar: The addition of 2 mL - [Elie Wiesel’s “Night”: Eliezer Analysis](https://schoolworkhelper.net/elie-wiesels-night-eliezer-analysis/) - There are moments in our lives that break us, changing us in unimaginable ways. Elie Wiesel, author of Night, has lived his life as a Holocaust survivor and has gone through things that are incomprehensible for many of us. He showcases the horrors that he and millions of Jews went through in the form of - [Kate Chopin’s Story of an Hour: Tragic Hero](https://schoolworkhelper.net/kate-chopins-story-of-an-hour-tragic-hero/) - Written at a time when feminism was not even a word, Kate Chopin’s "Story of an Hour" is one of the first feminine literary works in history, and has been critical to the rise of feminism throughout history. The story tells us about a woman who had recently lost her husband and portrays the various - [Canadian Charter Of Rights And Freedom: Sections Explained](https://schoolworkhelper.net/canadian-charter-of-rights-and-freedom-sections-explained/) - Section 1The Canadian Charter of Rights and Freedoms guarantees the rights and freedoms set out in it subject only to such reasonable limits prescribed by law as can be demonstrably justified in a free and democratic society. R v. OakesLower courts reference this case Sets precedent for whether or not judges should change the law - [Why Indigenous Literatures Matter by Daniel Justice: Summary and Analysis](https://schoolworkhelper.net/why-indigenous-literatures-matter-by-daniel-justice-summary-and-analysis/) - Why Indigenous Literatures Matter by Daniel Justice is a piece of literature that highlights how Indigenous people create honest and truthful stories about themselves that include their faults, but on the contrary, colonized stories about them make them seem out of place. In particular, the author shines a light on how stories made about Indigenous - [Shakespeare's Sonnet CIV: Imagery & Analysis](https://schoolworkhelper.net/shakespeares-sonnet-civ-imagery-analysis/) - To me, fair friend, you never can be old,For as you were when first your eye I eyed,Such seems your beauty still. Three winters coldHave from the forests shook three summers' pride,Three beauteous springs to yellow autumn turn'dIn process of the seasons have I seen,Three April perfumes in three hot Junes burn'd,Since first I saw - [Shakespeare's Sonnet CII: Imagery & Analysis](https://schoolworkhelper.net/sonnet-cii-imagery-analysis/) - My love is strengthened, though more weak in seeming;I love not less, though less the show appear;That love is merchandized, whose rich esteeming,The owner's tongue doth publish every where.Our love was new, and then but in the spring,When I was wont to greet it with my lays;As Philomel in summer's front doth sing,And stops his - [Interesting Facts about the Planets](https://schoolworkhelper.net/interesting-facts-about-the-planets/) - Mercury: Your weight on Mercury would be 38% of your weight on Earth. Mercury is the second densest planet. Earth is the only one with a higher density. Mercury has a molten core, unlike other inner planets. Mercury has the most craters of any planet, and the Caloris Basin is the largest impact crater on - [Conflict in Only Drunks and Children Tell the Truth](https://schoolworkhelper.net/conflict-in-only-drunks-and-children-tell-the-truth/) - “Home is a place you grow up wanting to leave, and grow old wanting to get back to” (John Ed Pearce). Janice was forced to leave her birth mother’s house 35 years ago and left again intentionally last year due to her overwhelming emotions. After this, her mother Anne dies, and Janice refuses to mourn - [Essay: Why is Canada’s Military in Decline?](https://schoolworkhelper.net/essay-why-is-canadas-military-in-decline/) - Canada’s military is said to be ironically sinking, caused by years of neglect and underfunding, the giant nation’s navy can no longer operate in global waters. The nation once had the 3rd best naval military in the world, then it dropped ranks to currently 23rd in the world. Even smaller nations can best this giant - [Trauma in The House on Mango Street](https://schoolworkhelper.net/trauma-in-the-house-on-mango-street/) - In the bildungsroman The House on Mango Street, there are many traumatic experiences to children, and childhood is seen as a time of tribulation and terror, at least through the eyes of Esperanza. Children, especially girls, are treated unfairly, and their key objective is to get married and move out of their mother’s houses. This - [Activity Series Lab Explained with Answers](https://schoolworkhelper.net/activity-series-lab-explained-with-answers/) - Introduction The universe is built upon chemical reactions. There are simply so many chemical reactions that change how we live, from the nuclear reactions in the Sun, to photosynthesis and digestion. Although every chemical reaction known is important for human survival, there are many types of chemical reactions ranging from nuclear to combustion. A single - [Activity Series Lab Answers](https://schoolworkhelper.net/activity-series-lab-answers/) - Introduction The purpose of the lab was to find which metal is the most reactive and which metal is the least reactive. It was known before the experiment that the metals used in the experiment are placed in the activity series from most active to least active as follows: magnesium, aluminum, zinc, and copper. The - [Point of View in The Lottery by Shirley Jackson](https://schoolworkhelper.net/point-of-view-in-the-lottery-by-shirley-jackson/) - A narrative point of view refers to what the narrator or character telling the story can see. Authors choose who is to tell the story by determining the point of view as the voice through which to tell a story. Events in a narrative can be told by characters who are involved in the narrative - [Story of an Hour: Louise Mallard Character Analysis](https://schoolworkhelper.net/story-of-an-hour-louise-mallard-character-analysis/) - Louise Mallard in the Story of an Hour is a great example of a tragic hero, because of her strange reaction to being newly widowed. Louise’s reaction to Brently’s death is unusual compared to how a stereotypical widowed woman’s grief would be. This coordinates quite well with the time period and society that Louise lives - [The Effect of the Earth’s Rotation & Revolution](https://schoolworkhelper.net/the-effect-of-the-earths-rotation-revolution/) - The Effect of the Earth’s Rotation & Revolution When watching the stars at night, they do appear to move very slowly. This is because the Earth is constantly moving. The Earth completes one “rotation” every twenty-four hours. A rotation is when the planet spins around once. The Earth rotates counterclockwise; this is why the Sun “rises” - [Timeline of George Washington's Presidency](https://schoolworkhelper.net/timeline-of-george-washingtons-presidency/) - [The Theme of Bildungsroman in Mary Shelley’s Frankenstein](https://schoolworkhelper.net/the-theme-of-bildungsroman-in-mary-shelleys-frankenstein/) - A bildungsroman is a novel that focuses on a protagonist’s moral, intellectual, and spiritual growth. In contemporary literature, the coming-of-age stories can be equated with the bildungsroman theme as they often deal with the challenging transition to adulthood from childhood. Shelley’s is a nineteenth-century novel that depicts the theme of bildungsroman by tracing the outcome - [The Theme of Bildungsroman in Charlotte Bronte's Jane Eyre](https://schoolworkhelper.net/the-theme-of-bildungsroman-charlotte-brontes-jane-eyre/) - A bildungsroman is a novel that focuses on a protagonist’s moral, intellectual, and spiritual growth. In contemporary literature, the coming-of-age stories can be equated with the bildungsroman theme as they often deal with the challenging transition to adulthood from childhood. In Jane Eyre, Charlotte Bronte traces the intellectual, moral, and psychological development of a young woman - [Revenge in Wuthering Heights by Emily Bronte](https://schoolworkhelper.net/revenge-in-wuthering-heights-by-emily-bronte/) - Revenge is a significant part of being human and refers to the desire to inflict retribution or inflict harm and hurt on others for wrongs or injuries suffered at their hands. The theme of revenge is recurrent in many literary or artistic works and is mainly associated with grief, hatred, and anger, hence used by - [Frida Kahlo’s Self-portrait Analysis](https://schoolworkhelper.net/frida-kahlos-self-portrait-analysis/) - Frida Kahlo’s Self-portrait dedicated to Leon Trotsky (1937) Frida Kahlo’s work has always been more than just depicting herself globally because her paintings are a way for her to translate her memories, culture, or experiences visually. Kahlo’s work is also a way of expressing especially the complex ideas running through her mind. Kahlo’s self-portraits are - [Perseverance: Odysseus’ Most Important Deed](https://schoolworkhelper.net/perseverance-odysseus-most-important-deed/) - Odysseus is the Hero in Odyssey the epic poem by Homer and is among the most frequently portrayed characters in world literature. According to the epic, Odysseus was Anticleia and Laertes's son, Penelope's husband, and Telemachus's father. Odysseus was also the king of Ithaca. Through his deeds, the epic portrays Odysseus as an individual of - [Perspective in The Lottery by Shirley Jackson](https://schoolworkhelper.net/perspective-in-the-lottery-by-shirley-jackson/) - A narrative point of view refers to what the narrator or character telling the story can see. Authors choose who is to tell the story by determining the point of view as the voice through which to tell a story. Events in a narrative can be told by characters involved in the narrative or from - [Cultural Conflict in Chinua Achebe's Dead Men's Path](https://schoolworkhelper.net/cultural-conflict-in-chinua-achebes-dead-mens-path/) - Chinua Achebe's Dead Men's Path is a short story published in 1953. Like Achebe's other novel, Things Fall Apart, Dead Men's Path confronts the clash between indigenous communities and colonialism. Michael Obi and his wife, Nancy, are enthusiastic about his posting as the new headmaster of Ndume Central School, a local school known for cultural backwardness and lack of progress. - [Things Fall Apart by Chinua Achebe: Summary and Analysis](https://schoolworkhelper.net/things-fall-apart-by-chinua-achebe-summary-and-analysis/) - Chinua Achebe's novel Things Fall Apart was published in 1958 and influenced Nigeria's literary renaissance in the 1960s. As the title suggests, Things Fall Apart is about the tragic downfall of a community and culture as an indigenous way of life crumbles from being assailed by foreign forces they do not understand and are unprepared for. The novel's first - [Use of Literary Devices in Stopping By Woods on a Snowy Evening](https://schoolworkhelper.net/use-of-literary-devices-in-stopping-by-woods-on-a-snowy-evening/) - Robert Frost’s poem Stopping by Woods on a Snowy Evening is a mysteriously impactful piece that goes beyond the literary meaning. Although written in simple language, Frost’s creative use of literary devices, including symbolism, personification, imagery, and foreshadowing throughout the poem, offers a deep meaning. Moreover, through these devices, Frost communicates significant themes such as - [Settings in Literature: Barn Burning and The Tempest](https://schoolworkhelper.net/settings-in-literature-barn-burning-and-the-tempest/) - Stories and poems are enshrined in different environments, culture, place and time. Additionally, the character and relationship with others are closely linked to the setting to help the audience understand the atmosphere and the context of place and time. Specific actions and behaviour are likely to unfold in certain environments, which is essential for the - [Gender Inequality in Charlotte Perkins' The Yellow Wallpaper](https://schoolworkhelper.net/gender-inequality-in-charlotte-perkins-the-yellow-wallpaper/) - The introduction of Charlotte Perkin’s short story The Yellow Wallpaper presents John (the antagonist) as a caring spouse and well-respected physician who strives to improve his wife’s mental health condition. The wife, who is an unnamed character, is diagnosed with a temporary nervous illness and John applies professional treatment and various medications among others the - [Mama Character Analysis in Alice Walker’s Everyday Use](https://schoolworkhelper.net/mama-character-analysis-in-alice-walkers-everyday-use/) - Mrs. Johnson, or Mama, the African American woman in Everyday Use, is the story’s narrator. The story revolves around Mama and her two daughters, Dee and Maggie, as well as how differently she relates to each daughter. The difference in her relationship with her daughters results from conflicting perspectives about the family’s heritage, which depicts Mama - [The Impact of War in “The Sun Also Rises” by Ernest Hemingway](https://schoolworkhelper.net/the-impact-of-war-in-the-sun-also-rises-by-ernest-hemingway/) - Ernest Hemingway's The Sun Also Rises is critically acclaimed and confronts various themes. One prominent theme is the impact of war on individuals, and having lived near war, Hemingway can be considered an authentic and credible source of information on this topic. In this novel, events linked to the war shape characters differently. Precisely, The - [Rhetoric Analysis "I Want a Wife" by Judy Brady](https://schoolworkhelper.net/rhetoric-analysis-i-want-a-wife-by-judy-brady/) - Judy Brady’s essay I Want a Wife generally applies several anecdotes to explore the demands of being a wife and gender roles and expectations. Speaking from her own experience, Brady is bitter about how demanding being a wife is and how the same demands are not expected of men. Overall, Brady’s concern is that the imbalance between - [Elie Wiesel's "Night": Theme of Hope](https://schoolworkhelper.net/elie-wiesels-night-theme-of-hope/) - Night is a novel based on a true story detailing the events of the holocaust and a narrative of hope about better days ahead. The main character, Elie experiences terrible things but hopes things will be better. However, Elie’s hope gets tested, especially at the concentration camp, where he experiences and witnesses terrible things such - ["Demonstration Day" by Sharon Olds Analysis](https://schoolworkhelper.net/demonstration-day-by-sharon-olds-analysis/) - Sharon Olds's poem Demonstrations Day is a free verse narrative that does not follow a particular rhythm of rhyme scheme structure. The free verse poem is long and does not contain sporadic rhymes but conveys powerful ideas and feelings as a demonstration poem. Precisely, Olds writes the poem to confront issues and make a stand against injustices - [Tone and Point of View in “A Rose for Emily” by William Faulkner](https://schoolworkhelper.net/tone-and-point-of-view-in-a-rose-for-emily-by-william-faulkner/) - In A Rose for Emily, William Faulkner uses different literary techniques to generate emotions from the writer and reader. Tone and point of view have been used to convey the narrator's sympathy and attitude toward Emily, the protagonist. Notably, A Rose for Emily is a tragedy with a dark twist where the protagonist suffers extreme - [Carol Anderson's "White Rage": Analysis](https://schoolworkhelper.net/carol-andersons-white-rage-analysis/) - In the book White Rage: The Unspoken Truth of Our Racial Divide, Carol Anderson confronts structural racism’s legacy conveyed through white resentment and shows how its persistence threatens the promise of America’s democracy. Anderson explores historical events like the Civil War, Reconstruction, passage of the Thirteenth Amendment, Civil Rights Act, the decision in Brown v. - [Gender Roles in Trifles by Susan Glaspell](https://schoolworkhelper.net/gender-roles-in-trifles-by-susan-glaspell/) - The play Trifles by Susan Glaspell is based on true events that happened at the turn of the 20th century in Iowa. Although a murder mystery, the play explores gender-based themes like power between males and females, gender roles, and gender relations, among others relevant to the play’s setting and contemporary society. Gender roles, in particular, are - [Central Limit Theorem](https://schoolworkhelper.net/central-limit-theorem/) - Would it be unusual for the mean of a sample of 3 to be 115 or more? Why or why not? Yes, it would be unusual for the mean of a sample of 3 to be 115 or more because the population's standard deviation is 15, so the mean of a selection of 3 would - [Kate Chopin's The Story of an Hour: Summary, Theme, Analysis](https://schoolworkhelper.net/kate-chopins-the-story-of-an-hour-summary-theme-analysis/) - Like most of Chopin's work, this story is a major sociopolitical force that confronted gender inequality and female powerlessness when women's suffrage and feminist movements had barely started in the United States. The author's life significantly influences the story, particularly her defiance of conventional gender roles. In most of Chopin's writings, she asserts personal opinions - [THE DIGESTIVE SYSTEM](https://schoolworkhelper.net/the-digestive-system/) - There are many organs and structures that make up the Digestive system and these organs or parts have key functions or roles to play which could include one or more of these: DIGESTION – mechanically or chemically breaking macromolecules to smaller units Mechanical: large food molecules are shredded, torn and ground; this helps to increase - [Diffusion, Osmosis, and Movement Across a Membrane](https://schoolworkhelper.net/diffusion-osmosis-and-movement-across-a-membrane/) - Biological Solutions Solutes are substances that are dissolved in a liquid to form a solution. The liquid that the solutes are dissolved in is referred to as a solvent. In biological systems, molecules that must enter or leave cells are the solutes and water is the solvent. Diffusion All particles are constantly and randomly moving. - [Boiling Points of Organic Compounds](https://schoolworkhelper.net/boiling-points-of-organic-compounds/) - As more carbons are added to a carboxylic acid, the trend indicates that the boiling point increases. The main functional group in a carboxylic acid (COOH) leads to strong bonds to start off with. The functional group (COOH) comes from combines the forces of a carbonyl group (polar covalent bonds, London forces, and dipole dipole - [Iodine Clock Reaction Lab Answers](https://schoolworkhelper.net/iodine-clock-reaction-lab-answers/) - Part A: Determining the complete rate law The order of reaction with respect to the iodate ion, m, must be determined for the following rate. It is assumed that the order of reaction with respect to the bisulfate is zero, thus n is zero. Sample calculation done for the first C2 value and the first - [pH Titration Lab Explained](https://schoolworkhelper.net/ph-titration-lab-explained/) - Introduction: An acid-base titration is a procedure that can be conducted to determine the concentration of an unknown acid or base. In an acid-base titration, a certain amount of a titrand with a known concentration is added to completely neutralize the titrand— the unknown concentration, reaching the equivalence point. The equivalence point is reached when - [Determination of Acetic Acid In Vinegar Lab Explained](https://schoolworkhelper.net/determination-of-acetic-acid-in-vinegar-lab-explained/) - Introduction The principal component of vinegar is acetic acid- HC2H3O2, and also a little bit of water. While analyzing vinegar and the percent composition of acetic acid in it, an acid/base reaction was performed by adding NaOH, a base, to vinegar, the acid. NaOH was added in small amounts at a time to a beaker - [Cell Anatomy & Organelles](https://schoolworkhelper.net/cell-anatomy-organelles/) - Nucleus: Contains most of the genetic info in the eukaryotic cell (some genes are located in mitochondria and chloroplasts) Contains 1 or more nucleolus surrounded by nuclear envelope Nuclear envelope: a double membrane that encloses the nucleus separating its contents from the cytoplasm. Nucleolus - appears as a mass of densely stained granules and fibres - [Human Cell & Cell Theory](https://schoolworkhelper.net/human-cell-cell-theory/) - A cell is the basic unit of life, and all organisms on earth are made up of cells. The animal cell is a member of the Eukaryotes, which are complex multi-cellular organisms(Eukaryote). This type of cell is also enclosed within a membrane. Animal cells can come in different shapes depending on how they are covered - [Ester Preparation Lab](https://schoolworkhelper.net/ester-preparation-lab/) - Introduction: An ester is an organic compound that is created from a reaction between an acid and an alcohol, usually with the loss of water. Many esters contain veer distinct odors, which has led to them being used for artificial flavoring and fragrances. Esters can be synthesized artificially in labs by combining alcohols and acids - [Haber Process](https://schoolworkhelper.net/haber-process/) - In order to produce as much ammonia as possible several factors need to be considered. The balanced chemical equation for this reaction is: Therefore a manufacturer would want to affect this equilibrium is such a way that the reaction would constantly wanted to shift to the right. The first way this could be achieved is - [Enzymes: Structure and Function](https://schoolworkhelper.net/enzymes-structure-and-function/) - Enzymes are specialized proteins that speed up chemical reactions (biological catalysts) Without enzymes, cellular chemical reactions could not occur fast enough to maintain life. Enzyme Activity: - enzyme binds to the reactants, called the substrate(s), of a chemical reaction - the substrate joins with the enzyme at the enzymes active site forming an enzyme-substrate complex - [The Endocrine System: Function and Structure](https://schoolworkhelper.net/the-endocrine-system-function-and-structure/) - Function: ▪ synthesize and release hormones permitting them to act in concert and respond to changes in the body and maintain stability (homeostasis) ▪ Example organs – thyroid, pancreas (islets of Langerhans), adrenal glands, pituitary gland Tools: - hormones * chemicals released by cells in one part of the body that affect cells in other - [Disease & Defense Against Disease](https://schoolworkhelper.net/disease-defense-against-disease/) - Pathogen – a disease causing organisms - May be: - viral (HIV, chicken pox) - bacterial (TB, strep) - fungal (athletes foot) - Protozoan (malaria = plasmodium) - Flatworm - Roundworm How to get infected? - airborne; waterborne; food; insect transmission; STI; skin Barriers to infection – skin, mucous membranes Specific defenses – production of - [The Effect of Hydrogen Peroxide on Liver: Hypothesis, Apparatus, Method](https://schoolworkhelper.net/the-effect-of-hydrogen-peroxide-on-liver-hypothesis-apparatus-method/) - Aim "To see what factors affect the decomposition of hydrogen peroxide by the enzyme catalase which is found in the liver" Introduction Enzymes are biological catalysts. They speed up the chemical reactions which go on inside living things. Without them the reactions would be so slow that life would grind to a halt. Enzymes work - [Themes and Symbols in To Kill a Mockingbird](https://schoolworkhelper.net/themes-and-symbols-in-to-kill-a-mockingbird/) - THEMES –the fundamental and universal ideas explored in a literary work Maturity Both Scout and Jem grow and mature throughout the novel. They develop in the physical, emotional, and rational sense. Different events in the novel force Scout and Jem to change or alter their perspectives on life, relationships, and the world. Prejudice & Bigotry - [The Language of Film](https://schoolworkhelper.net/the-language-of-film/) - The following is a basic list of some of the tools that are used by filmmakers to communicate meaning and message within their work. It is important to remember that film is a collaborative art form, so several people are a part of the process of creating meaning. When one is analyzing technique in a - [Regional Weather](https://schoolworkhelper.net/regional-weather/) - REGIONAL WEATHER - Even though weather is affected by large weather systems moving across Canada, weather can also be affected by the make-up of the local environment (example: living near a lake or mountain). - We’re going to be looking at five factors that affect regional (local) weather. THERMALS - Most winds are caused by - [Weather and Climate](https://schoolworkhelper.net/weather-and-climate/) - What is Weather? Weather describes atmospheric conditions in a given location over a short period of time, such as a day or a week. The atmospheric conditions include temperature, precipitation, wind, humidity, atmospheric pressure and the presence of fog, mist or cloud cover. What Causes Weather? The interactions of water air and the energy from - [Themes in John Dryden's All for Love (play)](https://schoolworkhelper.net/themes-in-john-drydens-all-for-love-play/) - Passion Perhaps the most essential theme in the play, and what keeps Cleopatra and Antony in a magnetic pull towards one another the entire time, is passion. Both lovers feel passionate—in both a sexual and romantic sense—towards one another. Their passion for one another exceeds all reason, which keeps Cleopatra and Antony continually making poor - [Psychopathy in American Psycho](https://schoolworkhelper.net/psychopathy-in-american-psycho/) - Based on a 1991 novel by Bret Easton Ellis, America Psycho (1999) tells of Patrick Bateman, a New York City banking Executive (Christian Bale) who conceals his psychopathic identity from his friends and colleagues as he ventures deep into violent indulgent fantasies. The young entrepreneur spends most of his time keeping up appearances for his - [Antigone: Sibling Rivalry, Gender Inequality and Democracy](https://schoolworkhelper.net/antigone-sibling-rivalry-gender-inequality-and-democracy/) - Although the play Antigone was written over two thousand years ago, it is frequently staged worldwide because it features themes relevant to a modern audience. The play features elements of human behavior, characteristics, and nature that remain unchanged over time, hence appealing to a contemporary audience because viewers can identify with themes throughout the play. - [Shakespeare’s Lady Macbeth: Manipulation & Ruthlessness](https://schoolworkhelper.net/shakespeares-lady-macbeth-manipulation-ruthlessness/) - When Lady Macbeth first appears in the play, she is learning of the witches' prophesies from a letter sent to her by Macbeth. Almost immediately after reading this letter, she starts to think of a way to assure that Macbeth becomes king. She wants to kill King Duncan. “Yet I do fear thy nature. It - [Liver Enzyme Lab Explained](https://schoolworkhelper.net/liver-enzyme-lab-explained/) - Problem How does repeated freezing and thawing affect the functioning of liver catalase? How does diluting or increasing the concentration of a solution affect the rate of reaction for liver catalase? Hypothesis Because freeze-thaw cycles lead to the denaturation of a protein, and because denaturation is permanent, the enzyme activity will decrease exponentially with the - [Protein Synthesis Lab Answers](https://schoolworkhelper.net/protein-synthesis-lab-answers/) - The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Find the correct order the 3 fragments must be in. Recopy the DNA code for the GENE in order from - [Loss of Innocence in The Lord Of The Flies](https://schoolworkhelper.net/loss-of-innocence-in-the-lord-of-the-flies/) - Turning on those closest to us is a form of destructive behaviour as it always ends in devastation and loss of one’s self. Jack advocates for being a leader in the democratic leadership style they started with, but he begins to disagree with it and wants more power in the dictatorship leadership style he creates. - [Lab Explained: Acids & Bases Titration Lab](https://schoolworkhelper.net/lab-explained-acids-bases-titration-lab/) - Table 1 - All Attempted Trials Between The Acid “Unknown B”, And The Base, (NaOh). Table 2: Successful Titration Trials Between Acid “Unknown B”, And Base, (NaOh), Where Endpoint Was Achieved Goal: Find the concentration of acid “Unknown B” if 10mL of acid was neutralized completely with a base solution of sodium hydroxide that has - [Lab Explained: Antibiotic Resistance Lab](https://schoolworkhelper.net/lab-explained-antibiotic-resistance-lab/) - Introduction: Bacteria does not have a membrane-bound nucleus and other internal structures (Kara Rogers, 2020), which it, therefore, classifies as a prokaryotic cell. Bacteria reproduce in 2 different ways, binary fission and conjugation. Binary fission is an asexual reproduction method that only involves 1 parent cell and the genes from the parent cell gets passed - [Lab Explained: Isotonic Salt Concentration of Celery & Active Transport in Yeast Cells](https://schoolworkhelper.net/lab-explained-isotonic-salt-concentration-of-celery-active-transport-in-yeast-cells/) - Problem: What is the isotonic salt concentration of celery? How does boiling yeast cells affect active transport? Hypothesis: Osmosis is a process in which solvent molecules flow and pass through a semipermeable membrane. The semipermeable membrane allows the passage of the solvent, but not the solutes. The water in an object flows through the region - [Essay: Healing Power And Spiritual Benefit Of Storytelling](https://schoolworkhelper.net/essay-healing-power-and-spiritual-benefit-of-storytelling/) - Indigenous stories share common-sense understandings and moral teachings; they function as spiritual and mental medicine. Storytelling is a widely practiced and celebrated part of Indigenous culture for connecting Indigenous peoples to their culture and spiritual identities. It serves to heal traumas such as cultural genocide, racially motivated hate crimes, various types of substance abuse, and - [1789 French Revolution and Dechristianization of France](https://schoolworkhelper.net/1789-french-revolution-and-dechristianization-of-france/) - In 1789, a revolution swept across the land of Joan of Arc, which began the dechristianization of France. Throughout the revolution, the new revolutionary authorities suppressed the Catholic Church, abolished the Catholic monarchy, nationalized church property, exiled 30,000 priests, and killed hundreds more. When the revolution began, France had gone to war with Britain and - [Lasers: History & Function](https://schoolworkhelper.net/lasers-history-function/) - The laser is a device that generates a beam of light. The beam is produced by a process known as stimulated emission, and the word "laser" is an acronym for the phrase "light amplification by stimulated emission of radiation." Similar to radio waves, light can also carry information. The information is encoded in the beam - [Timeline for Atomic Theory Development](https://schoolworkhelper.net/timeline-for-atomic-theory-development/) - 432 BCE- Empedocles Empedocles was responsible for separating air as a separate substance. In his beliefs air, fire, water, earth mingle and separate under the compulsion of love and strife. 440 BCE- Democritus Democritus’s theory was the first theory to be contributed to the atomic theory. He proposed that the entire world was made up - [The Truman Show: Themes and Analysis](https://schoolworkhelper.net/the-truman-show-themes-and-analysis/) - A movie so influential that a syndrome has been named after it. The Truman syndrome entails those afflicted with the disorder to believe their lives are reality television shows. The Truman show came out in 1998, starring Truman Burbank, the protagonist of the story who is unaware that his everyday life is being televised continuously - [Fermentation of Glucose by Yeast: Lab Explained](https://schoolworkhelper.net/fermentation-of-glucose-by-yeast-lab-explained/) - Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food - [Power of Fear in Politics: Machiavellian Analysis](https://schoolworkhelper.net/power-of-fear-in-politics-machiavellian-analysis/) - A central problem of politics is how to obtain and hold onto power. The Christian contemporary belief was that true power comes from those who are merciful, peaceful, generous, and tolerant; in other words, a good politician is a good Christian. In contrast, Machiavelli argued that an effective ruler needs to know how to be - [Imagery in Simon Armitage's The Parting Shot and Remains](https://schoolworkhelper.net/imagery-in-simon-armitages-the-parting-shot-and-remains/) - Simon Armitage uses imagery that relates to guilt and sorrowfulness to explore grief in the two poems, the Parting shot and Remains. In Parting shot, for example, the soldier has survivor's guilt which relates to him having grief for his friend who died on the battlefield, he also goes to his dead friend's funeral, which - [Hitler’s Consolidation of Power: The Night of Long Knives](https://schoolworkhelper.net/hitlers-consolidation-of-power-the-night-of-long-knives/) - What was the Night of Long Knives? The Night of Long Knives, also known as the Röhm Putsch, was the purge of the SA leadership and other political opponents from 30 June 1934 to 2 July 1934. It was a turning point for the German government. Hitler launched the Night of Long Knives to consolidate - [Forensic Odontology](https://schoolworkhelper.net/forensic-odontology/) - In the realm of science, forensic dentistry is fast expanding its space. Forensic odontology is a specialized field of dentistry that analyses dental evidence in the interest of justice. It has been established as an indispensable science in medico-legal matters and identifying the mutilated, unknown dead person. Various methods have been developed to determine age, sex, - [What is Poetry?](https://schoolworkhelper.net/what-is-poetry/) - What exactly is poetry? Poetry is one of the oldest means of remembering and maintaining history. It is very difficult, if not impossible, to give a precise definition of poetry, but this doesn’t necessarily matter as we can have a perfect understanding of what something is without being able to define it. Poetry itself is - [The Trolley Problem: Ethics Essay](https://schoolworkhelper.net/the-trolley-problem-ethics-essay/) - The Trolley Problem, a thought experiment in which the individual determines the value of human life, deciding whether it is worth sacrificing an individual in order to save 5. In our growing world, a similar problem arises with the innovation of self-driving cars. In the case of an unavoidable accident, who does the car decide - [Refractive Indices of Water and Oil: Lab Explained](https://schoolworkhelper.net/refractive-indices-of-water-and-oil-lab-explained/) - 1. AIM/ PURPOSE: The aim of this experiment is pretty simple. It is to measure the refractive index of the light while it moves from one medium to another. Depending on the refractive indexes of both mediums, the angle of refraction will be at a greater or lesser angle. The angles are measured from the - [President Ronald Reagan’s John F. Kennedy Speech: Analysis](https://schoolworkhelper.net/president-ronald-reagans-john-f-kennedy-speech-analysis/) - Former president John F. Kennedy left a permanent mark on the world we live in, and his time has been reminisced upon by many. One of these many is the influential president Ronald Reagan, who delivered a speech about his views and opinions of Kennedy at his fundraising event on June 24, 1985. Reagan had - [Clifford Stoll’s The Cuckoo's Egg: Summary](https://schoolworkhelper.net/clifford-stolls-the-cuckoos-egg-summary-analysis/) - "The Cuckoo's Egg" is a compelling tale of perseverance, passion for one's job, and humor! The narrative begins with the introduction of Clifford Stoll, who was "recycled" to become a computer analyst and webmaster. Cliff, a former astronomer turned mainframe specialist, worked at Lawrence Berkeley Lab. He was reassigned to the computer lab after his - [The Last Unicorn: Molly Grue Analysis](https://schoolworkhelper.net/the-last-unicorn-molly-grue-analysis/) - Literature has the power to transport us to other worlds and introduce us to characters who stay with us long after we finish reading their stories. And in Peter S. Beagle's novel, The Last Unicorn, we meet one such character in the form of Molly Grue. Molly is a woman who undergoes a profound transformation - [Malorie Blackman's Noughts & Crosses: Summary](https://schoolworkhelper.net/malorie-blackmans-noughts-crosses-summary/) - Noughts and Crosses, also known as Tic-Tac-Toe, has traditionally been seen as a lighthearted and educational game for children. However, in this Carnegie-Medal-winning sequel, the game takes on a much more significant and thought-provoking role. The story begins with the introduction of Sephy, formally known as Persephone Hadley. Sephy is a Cross, meaning she has - [Shakespeare’s Twelfth Night: Act I-V Summaries](https://schoolworkhelper.net/shakespeares-twelfth-night-act-i-v-summaries/) - Act One Scene one This scene introduces us to the Duke, who is in love with a girl called Olivia. His servant goes to ask her whether or not she would like to go out with the Duke. The message back from her servant is that Olivia will not be seen in public for seven - [Defamation of Character & Defenses for Defamation](https://schoolworkhelper.net/defamation-of-character-defenses-for-defamation/) - Defamation is an unjustified or untrue attack on someone’s reputation. It may be an intentional or unintentional attack that lowers a person’s reputation, cause people to avoid him or her, or expose that person to hatred, contempt, or ridicule. If your reputation has been damaged, you may sue for damages, but you will only get - [Type of Legal Defenses](https://schoolworkhelper.net/type-of-legal-defenses/) - Even in cases of intentional tort, the defendant may escape liability as a result of several defenses: Consent – is very common in regard to an action in battery. If you and your friends agree to play road hockey and one of you is injured, the defendant may successfully argue that you consented to the - [Lab Explained: Carbon Dioxide Production by Yeasts under Different Temperatures](https://schoolworkhelper.net/lab-carbon-dioxide-production-by-yeasts-under-different-temperatures/) - Problem: Yeasts undergo aerobic cell respiration if there is sufficient oxygen and releases carbon dioxide as a waste product. Yeasts, like any other cells, have an optimum temperature at which they work most efficiently, including the process of cell respiration. This experiment aims to discover the relation between temperature and the carbon dioxide yield of - [Causes of World War II](https://schoolworkhelper.net/causes-of-world-war-ii/) - Thus far, World War II has been the deadliest and bloodiest war. More than 38 million people died by the end of the war, many of them innocent civilians. It was also the most destructive war in our current history. The fighting raged on in many parts of the world, with the brunt of it - [Theme of Love and Money in Victorian Era Novels](https://schoolworkhelper.net/theme-of-love-and-money-in-victorian-era-novels/) - Many novels about the middle class in the nineteenth century are mainly about the struggles of common citizens and the struggles of the lower class. Precisely, the novels feature the struggles of the lower citizens’ efforts to gain upward mobility, which gave rise to the social realism subgenre. Jane Eyre by Charlotte Bronte, Great Expectations by Charles Dickens, Sense and - [Parental Negligence in The Stone Boy by Gina Berriault](https://schoolworkhelper.net/parental-negligence-in-the-stone-boy-by-gina-berriault/) - Gina Berriault’s story The Stone Boy prompts readers to consider how much parental involvement influences a child’s actions and behavior. The story tells of how 9-year-old Arnold accidentally kills his older brother Eugene but decides to pick peas for an hour instead of informing his parents about the incident. His family, relatives, the sheriff, and the callers - [Antigone’s Relevance in Modern Society: Analysis](https://schoolworkhelper.net/antigones-relevance-in-modern-society-analysis/) - In Greek Legend, Antigone is the daughter born of the inadvertent relationship between Jocasta and her son Oedipus. The tragedy by Sophocles is narratively anteceded by Oedipus at Colonus and Oedipus Rex and forms the third installment of the Oedipus trilogy. Over the years, there have been multiple adaptations of Antigone, including musical compositions, stage, - [Dulce et Decorum Est: Futility of War](https://schoolworkhelper.net/dulce-et-decorum-est-futility-of-war/) - Wilfred Owens, a former soldier in WW1, defies the perception of war in his poem ‘Dulce et Decorum Est’ by unraveling a sample of the horror that comes from warfare, on and off the battlefield, to denounce the ‘old lie’, that is sweet and fitting to die for one’s country. Owens’s poem contrasts the expectations - [Conflict in Around the World in Eighty Days](https://schoolworkhelper.net/conflict-in-around-the-world-in-eighty-days/) - In the novel, Around the World in Eighty Days, by Jules Vern, Phileas Fogg is in conflict with time in a man versus nature conflict. Phileas Fogg is a very precise and honorable Englishman who made a bet that he could circumnavigate the world in eighty days. He is in a conflict with time, trying to - [Around the World in Eighty Days: Phileas Fogg Character Analysis](https://schoolworkhelper.net/around-the-world-in-eighty-days-phileas-fogg-character-analysis/) - In the story, Around the World in Eighty Days by Jules Vern, Phileas Fogg, an eccentric Englishman gentleman, must travel around the world in eighty days. This is the result of his making a bet with the members of the Reform Club. As the story advances, Phileas Fogg is faced with the difficult task of traveling around - [Stopping by Woods on a Snowy Evening by Robert Frost: Analysis](https://schoolworkhelper.net/stopping-by-woods-on-a-snowy-evening-by-robert-frost-analysis/) - Whose woods these are, I think I know. 1 His house is in the village, though; 2 He will not see me stopping here 3 To watch woods fill up with snow. 4 My little horse must think it queer 5 To stop without a farmhouse near 6 Between the woods and frozen lake, 7 - [Acid Rain Experiment: Lab Report Explained](https://schoolworkhelper.net/acid-rain-experiment-lab-report-explained/) - Introduction: Acid rain has an acidity of around 4, which is 1000 times more acidic than normal rain. When humans burn fossil fuels, sulphur dioxide (SO2) and nitrogen oxides (NOx) are released into the atmosphere. Those air pollutants react with water, oxygen, and other substances to form airborne sulfuric and nitric acid. Winds may spread - [Homelessness in America: What Can Be Done to Amend This Crisis](https://schoolworkhelper.net/homelessness-in-america-what-can-be-done-to-amend-this-crisis/) - Homelessness in America has a history dating back to the 1870s, according to the National Center for Biotechnology Information (NCBI), which is a part of the US National Library of Medicine and reports on biomedical and genomic information. The crisis surged in the 1980s as a result of high unemployment, a lack of affordable housing, - [Charles Dickens' Great Expectations: Pip’s Ambitions](https://schoolworkhelper.net/charles-dickens-great-expectations-pips-ambitions/) - Charles Dickens' Great Expectations was written during great social change. The novel appealed to the middle and working classes of the Victorian Era and was highly critical of the class system and social inequality. Pip represents the social change of the time, constantly wanting to better themselves. Pip was very much content with life as - [Hermann Hesse’s Demian: Summary & Analysis](https://schoolworkhelper.net/herman-hesses-demian-summary-analysis/) - Hermann Hesse’s novel Demian tells the story of a young boy named Emil Sinclair and his childhood growing up during pre-World War I. Emil struggles to find his new self-knowledge in the immoral world and is caught between good and evil, which is represented as the light and dark realms. Hesse uses much symbolic diction - [Ancient Greek Recreation & Activities](https://schoolworkhelper.net/ancient-greek-recreation-activities/) - Hunting: was enjoyed by the aristocratic populace (slave bears, horses, dogs. Lion hunting; was the preview of royalty, a sport of nobility.Fishing: was seen as more of a job; Ancient sources mention one fishmonger winning the Olympia. Aquatic sports: such as swimming, were only used as a way of training for other sports (recreational, not - [Jon Krakauer’s Into Thin Air: Summary & Theme](https://schoolworkhelper.net/jon-krakauers-into-thin-air-summary-theme/) - Author Jon Krakauer is the author of three books, including Eiger Dreams and the acclaimed bestseller Into the Wild. He is also the contributing editor of Outside magazine. He and his wife live in Seattle Into thin Air is a great adventure story about Jon Krakauer's ascend of Mt. Everest. Krakauer was a member of - [Insanity in The Tell Tale Heart by Edgar Allan Poe](https://schoolworkhelper.net/insanity-in-the-tell-tale-heart-by-edgar-allan-poe/) - The Tell Tale Heart is among Poe's most famous short stories. It provides a dark and bleak exposition by an unnamed character who narrates how he successfully murders and their ultimate delirious confession from guilt's torment. The narrator's motiveless action arouses the readers' curiosity about the storyteller's mental state and the relationship with the old man - [Right Decisions in Sophocles' Antigone](https://schoolworkhelper.net/right-decisions-in-sophocles-antigone/) - People often seem different by the decisions they make and the actions they take making. One can easily be judged by their values and the vision and goals they pursue without others considering their inner characters. Nonetheless, despite these differences, two people can have similar personalities. For example, in Sophocles’ Antigone, Creon and Antigone have - [Othello: Protagonist and Antagonist](https://schoolworkhelper.net/othello-protagonist-and-antagonist/) - The two characters of Othello and Iago are gradually revealed to the audience as the first act unfolds. Othello is the protagonist in the play, which revolves around his corruption by Iago, the antagonist, and his increasing jealousy. Both protagonists and antagonists are linked to one another from how they address each other and talk - [Causes of Unemployment in Australia and its Impact on the Economy](https://schoolworkhelper.net/causes-of-unemployment-in-australia-and-its-impact-on-the-economy/) - Outline the main causes of unemployment in Australia and discuss its impact on the economy Unemployment is the situation where individuals want to work, however, are unable to find a job. Many causes disable Australians from seeing and being accepted for adequate work, in addition to the many impacts on the individual people and the - [The Similarities and Differences in the Adventures of Sherlock Holmes](https://schoolworkhelper.net/the-similarities-and-differences-in-the-adventures-of-sherlock-holmes/) - The Adventure of Crooked Man is among Arthur Conan Doyle's short stories about Sherlock Holmes. The short story is the twentieth of the Sherlock Holmes stories, written for the Strand Magazine edition, after The Adventure of the Reigate Squire. The story was later republished and included in The Memoirs of Sherlock Holmes omnibus in 1893. - [Greek Tragedy: Antigone and Ismene Comparison](https://schoolworkhelper.net/greek-tragedy-antigone-and-ismene-comparison/) - The personalities of the two sisters, Antigone and Ismene, are as different from one another as tempered steel is from a cotton ball. One is hard and resistant; the other: is pliable, absorbing, and soft. Antigone would have been a strong, successful 90's type woman with her liberated and strong attitude towards her femininity, while - [The Main Differences Between Old and New Labour Party](https://schoolworkhelper.net/the-main-differences-between-old-and-new-labour-party/) - After the devastating defeat on the hands of the conservatives in 1979, the torn Labour party had to go through a series of changes to reassert its internal structure and organization. From the Bennite Challenge that redressed and centralized the power of decision making inside the party to the rejection of nationalization and crushing the - [Types of Dramatic Devices](https://schoolworkhelper.net/types-of-dramatic-devices/) - Dramatic Irony Occurs when the reader knows a secret, but the characters in a play or work of fiction do not. Therefore, the words or actions of a character carry a special meaning for the reader but are understood differently by the character. The characters are blind to facts, but the reader is not. Nemesis - [The Causes of Moral Growth in To Kill A Mockingbird](https://schoolworkhelper.net/the-causes-of-moral-growth-in-to-kill-a-mockingbird/) - Countless things impact moral growth in a person, with some forms being more effective than others. In the novel To Kill A Mockingbird written by Harper Lee, three factors that can influence an individual's moral growth are shared. The three significant elements that impact an individual's moral development are the environment lived in, maturity, and parental guidance. - [Frank Lincoln Wright: American Architect & Biography](https://schoolworkhelper.net/frank-lincoln-wright-american-architect-biography/) - CHILDHOOD Born in Richland Center, in southwestern Wisconsin, on June 8, 1867 (Sometimes reported as 1869), Frank Lincoln Wright (Changed by himself to Frank Lloyd Wright) was raised in the influence of a welsh heritage. The Lloyd-Jones family, his mother's side of the family, had a great influence on Mr. Wright throughout his life. The - [Frank Auerbach: Biography & Painting](https://schoolworkhelper.net/frank-auerbach-biography-painting/) - One of Britain's leading post-war painters, Frank Auerbach, is among the most internationally acclaimed and collected living artists from Britain. The painting style of Frank Auerbach is both compactly expressionistic and highly individual. Determined by his desire to capture the spirit and reality of people and places, his paintings, which he works and re-works, produce - [Isaac Asimov's Nemesis: Characters & Theme](https://schoolworkhelper.net/isaac-asimovs-nemesis-characters-theme/) - Isaac Asimov was born in 1920 in Petrovichi, Russia. When he was three years of age, his family immigrated to the United States and settled in Brooklyn, New York. Asimov turned to full time writing in 1958. This accomplished writer is best known for his novels dealing with science fiction. However, his works extend to - [Pendulum Physics Lab: Answers & Explanation](https://schoolworkhelper.net/activity-6-1-1-the-pendulum-physics-assignment/) - Introduction A pendulum is a mass on the end of a string of negligible mass, which, when initially displaced, will swing back and forth under the influence of gravity over its lowest point. The regular motion of a pendulum can be used for timekeeping. Problem To identify the relationships between the frequency of a simple - [Diagnosing Blood Diseases Analysis Questions](https://schoolworkhelper.net/diagnosing-blood-diseases-analysis-questions/) - 1) Function of: Red Blood Cell: Carry Haemoglobin White Blood Cell: Defending the body, removing infection Platelets: Blood Clotting 2) 5.5 billion per male/ 4.5 billion per female 3) 7,800,000 per male/ 6,430,000 per female 4) 150,000- 450,000 5) Red Blood Cells, Platelets, White Blood Cells 6) No. 7) This is because they are missing the “Helper T cell” (aka - [Artificial Sweeteners Analysis Questions](https://schoolworkhelper.net/artificial-sweeteners-analysis-questions/) - 1) What does positive test mean? A positive test result indicates the present of whatever nutrient is being tested for. 2) What is the purpose of having a control? A control, such as distilled water, provides a basis to compare all results. Distilled water, which has been treated to remove all mineral and proteins, should - [Animal Farm Critical Passage](https://schoolworkhelper.net/animal-farm-critical-passage/) - November came, with raging south-west winds. Building had to stop because it was now too wet to mix the cement. Finally there came a night when the gale was so violent that the farm buildings rocked on their foundations and several tiles were blown off the roof of the barn. The hens woke up squawking - [Animal Farm Plot: Summary & Character Analysis](https://schoolworkhelper.net/animal-farm-plot-summary-analysis/) - Animal Farm is a novel by George Orwell. Published in England on 17 August 1945, the book reflects events leading up to and during the Stalin era before World War II. Orwell, a democratic socialist, and a member of the Independent Labour Party for many years, was a critic of Joseph Stalin, and was suspicious - [Animal Farm Monologue: Squealer](https://schoolworkhelper.net/animal-farm-isu-monologue-squealer/) - Comrades, our Windmill has fallen in the night and crushed our crop but not our spirits. Our great leader, Napoleon, has discovered the treacherous Snowball, like an owl, has come in the night and under the cover of the wicked storm and laid waste to our marvel of work. Do not fear comrades, this heinous - [Punishments for Murderers](https://schoolworkhelper.net/punishments-for-murderers/) - Murder Canada: First degree murder - mandatory life imprisonment without the possibility of parole for 25 years (but someone guilty of a single murder could be have his non-parole period reduced to no less than 15 years (see Faint hope clause). Second degree murder - mandatory life imprisonment without the possibility of - [Breathing Lab: Discussion Questions/ Answers](https://schoolworkhelper.net/breathing-lab-discussion-questions/) - Member 1= 316200mL per day.Member 2 = 280800mL per day.Member 3= 302400mL per day.316200+280800+302400/3=899400/3=299800mLOn average our group takes in 299800mL of air per day. If I had just been working out before the lab then my breathing rate would be faster because my body would require more oxygen to meet my ATP consumption and ensure - [How we Hear: Speakers, Microphones, Reverberation, Screeh, Delay](https://schoolworkhelper.net/audio-reproduction-speakers-and-microphones/) - Microphone Transducers, devices that change information from one form to another. A microphone consists of a diaphragm, a magnet, and a coil of wire. When you speak into it sound waves created by your voice vibrate the diaphragm which is connected to the magnet which is inside the coil of wire. These vibrations cause the - [Bill C-484: Significance & Importance](https://schoolworkhelper.net/bill-c-484/) - R. v. Sullivan 1) Under the pretences of the criminal code of Canada: Criminal negligence 219. (1) Everyone is criminally negligent who (a) in doing anything, or (b) in omitting to do anything that it is his duty to do, shows wanton or reckless disregard for the lives or safety of other persons. Definition of - [Courtroom Procedure](https://schoolworkhelper.net/courtroom-procedure/) - Decision by Judge or Jury- Defence generally decides whether a case will be tried to a judge or a jury. In some regions both prosecution/ defence have right to demand a jury trial. Jury selection- If trial is held before a jury: defence/ prosecution select the jury through a question and answer process: "voir dire." - [Ticker Tap Lab Discussion Questions](https://schoolworkhelper.net/ticker-tap-lab-discussion-questions/) - 1) The average velocity for an interval can be found by finding the slope of that interval. Using the tangent method or mid-point method to find the rise/run will give you the average velocity of the cart at that interval. 2) For constant acceleration, the average velocity for the interval will be equal to the - [China has 44 million missing women: Case Study](https://schoolworkhelper.net/china-has-44-million-missing-women-case-study/) - 1) The case study basically explains the segregation and problematic child gender problems that still exist in many parts of India, southern Asia, and China. Long- established traditions of turning females into commodities as oppose to people are creating large imbalances in the male to female birth ratios each year. The government being aware of - [Enforcement and Application of Charter Rights and Freedoms](https://schoolworkhelper.net/enforcement-and-application-of-charter-rights-and-freedoms/) - R. v. Oakes, [1986] 1 S.C.R. 103 1) Reverse onus: A stipulation within the Criminal Code of Canada that shifts the “burden of proof” onto the individual to disprove evidence against them and prove their innocence. Usually, this provision concerns a shift in burden onto a defendant in either a criminal offence or “tort” case. - [Steps in Product Development](https://schoolworkhelper.net/product-development/) - In the world of marketing, there are several steps in which a company must take in order to release a product into the market and be a success. Step 1: Idea Generation Ideas for new products can be obtained from basic research using an SWOT analysis, market and consumer trends, company's R&D department, focus groups, - [R. v. Greyeyes](https://schoolworkhelper.net/r-v-greyeyes/) - 1) No, no where in the section defining what constitutes the offence of trafficking does it state the accused must be in direct possession of the illegal substance. 2) Aiding and Abetting - The guilt of a person in a criminal case may be proved without evidence that he personally did every act involved in - [R. v. Parker](https://schoolworkhelper.net/r-v-parker/) - R. v. Parker 1) Section 7 of the Charter of guarantees “Everyone has the right to life, liberty and security of the person and the right not to be deprived thereof except in accordance with the principles of fundamental justice.” 2) The court declared the possession of marijuana for medical purposes to be unconstitutional because - [Ban on driving distractions passes final reading](https://schoolworkhelper.net/ban-on-driving-distractions-passes-final-reading/) - Increased reliance on cell phones has led to a rise in the number of people who use the devices while driving. There are two primary dangers associated with driving and cell phone use, including text messaging. First, drivers must take their eyes off the road while dialling. Second, people can become so absorbed in their - [Does Sports affect Academic Average?](https://schoolworkhelper.net/does-sports-affect-academic-average/) - Problem/ Hypothesis Many students in high school participate in sports teams throughout the school year. They may participate seasonally, or full time. The significance of this study is that we may find a bridge between sports and academics, whether negative or positive. We have hypothesized that, surely the time dedicated to a sports team takes - [Criminals: Born or Made?](https://schoolworkhelper.net/criminals-born-or-made/) - Nurture It is a fact that sensory areas of the brain can only develop when the environment contains sensory stimuliCommitting a crime is not something a person is born knowing to doBased on the assumption that the positive or negative effects of nurture from a parent will directly affect the positive or negatives attitude displayed - [Hamlet Essay](https://schoolworkhelper.net/hamlet-essay/) - It can be argued that Hamlet, is one of the greatest tragedy pieces written by William Shakespeare throughout his life. The play provides conflict between a variety of personalities all in the pursuit of power or their own interruption of moral justice. It encompasses the themes of deception, manipulation, and malevolence to create the “perfect - [Forms of Energy](https://schoolworkhelper.net/forms-of-energy/) - Energy forms are either potential or kinetic. Potential energy comes in forms that are stored including — chemical, gravitational, mechanical, and nuclear. Kinetic energy forms are doing work — like electrical, heat, light, motion, and sound. Forms of Energy Form of Energy Description Thermal The atoms and molecules of a substance possess thermal energy. The - [Fish and Shark Information](https://schoolworkhelper.net/fish-and-shark-information/) - Fish: Aquatic vertebrate animals Typically cold-blooded Covered with scales Equipped with two sets of paired fins and several unpaired fins Kingdom: Animalia Phylum: Chordata The anatomy of Lampanyctodes hectoris (1) - operculum (gill cover), (2) - lateral line, (3) - dorsal fin, (4) - fat fin, (5) - caudal peduncle, (6) - caudal fin, (7) - [Jane Goodall & the Chimpanzees of Gombe](https://schoolworkhelper.net/jane-goodall-the-chimpanzees-of-gombe/) - 1) The primary method that Jane Goodall, was she watched the chimpanzees from a distance for months; such methods were ground breaking. Ultimately, the chimpanzees accepted her presence among them and allowed her to move closer. She named the individual chimpanzees she had come to observe, a gesture that went against the long-standing scientific tradition - [Should Euthanasia Be Legalized?](https://schoolworkhelper.net/should-euthanasia-be-legalized/) - 1) The patient must be suffering unbearable pain. I am somewhat in agreement with this provision of the Dutch law. If a person is suffering for extraordinary pain from a severe accident or terminal disease which renders them a burden on themselves and others around them, they should be able to make the conscious decision - [Animal Farm Essay](https://schoolworkhelper.net/animal-farm-essay/) - Throughout George Orwell’s novel, Animal Farm, the accumulation of power results from language and the use of rhetoric. Through language and the authority of words, the expulsion of Mr. Jones transpires and the undemocratic ascension of Napoleon’s dictatorship is made possible. The remarkable rhetorical and articulation ability of the pigs and their skillful manipulation of - [Lab: Refraction of Light- Air into Glass Answers](https://schoolworkhelper.net/lab-refraction-of-light-air-into-glass/) - Lab Answers and Analysis 1) A ray directed along a normal does not refract as it moves from one medium another; refraction will occur if the ray is travelling on an angle different from that of the normal through two different mediums. 2) When light travels from air to glass at an angle of incidence - [Memento Movie: Explanation and Summary](https://schoolworkhelper.net/memento-movie-explanation-and-summary/) - Leonard suffered from Anterograde amnesia, the loss of memory of what happens after the event that caused the amnesia, his wife’s murder (or, more commonly, short-term memory loss). This prevented him from holding memories after his wife’s rape/ murder in his brain for longer than a short time until they were forgotten. Due to this - [The White Squall Essay](https://schoolworkhelper.net/the-white-squall-essay/) - The movie “White Squall” takes place in the 1960s upon the schooner “Albatross”. Thirteen boys from across the United States were collectively brought together for an eight month stay upon the boat to be educated and hopefully find direction in their lives. Under the guidance of Christopher “Skipper” Sheldon and his wife Dr. Alice Sheldon, - [R v. Turner (S.A.)](https://schoolworkhelper.net/r-v-turner-s-a/) - 1) John Ryan’s mother was charged with manslaughter and not infanticide because she lacked the perquisite to be charged with it. In order for this case to have been possibly considered infanticide, John Ryan’s mother would have to have committed the murder during the first 12 months of his life. Since his mother does not - [Rain Man (1988): Movie Summary & Analysis](https://schoolworkhelper.net/rain-man-the-movie-analysis/) - What conditions does Raymond suffer from? According to the movie, Raymond is an autistic savant. Though somewhat mild, his autism has led to impaired social interaction and communication, and restrictive and repetitive behavior. Also, his echolalia causes him to repeat vocalizations made by other people even if he doesn’t understand them. Furthermore, his savantism gives - [Motion Lab: A Stroll in the Hall (Discussion & Answers)](https://schoolworkhelper.net/motion-lab-a-stroll-in-the-hall/) - Introduction In the study of physics, velocity is defined as the rate of change in position in accordance to a reference point. It is therefore a vector quantity; both the scalar quantities of speed and direction are required to define it. In the SI system, it is measured in meters per second: (m/s) [N] meaning - [Stanley- Milgram Experiment](https://schoolworkhelper.net/stanley-milgram-experiment/) - Purpose: To measure the willingness of participants to obey an authority figure who instructed them to perform acts that conflicted with their personal conscience. Method: 1) The participant (T) arrives at the testing facility and is “forced” into the position of Teacher. The accomplice to the experiment (L) gets the Learner position and each individual - [Allergic Reactions & Allergies: Causes & Treatment](https://schoolworkhelper.net/allergic-reactions-and-allergies/) - Allergy is a disorder of the immune system often also referred to as atopy. Allergic reactions occur to normally harmless environmental substances known as allergens; these reactions are acquired, predictable and rapid. Mind allergies can range from hay fever which causes runny nose and itchy eyes, to life-threatening anaphylactic reactions and potentially death. Allergies are - [Periodic Table Assignment Answers](https://schoolworkhelper.net/periodic-table-assignment-answers/) - ACROSS 1. Synthetic elements with atomic numbers greater than 93 (Transuranic) 5. This law states that the properties of elements repeat as a function of their atomic number (Periodic) 7. Silicon is in this period (Three)8. Elements were originally placed in order of atomic __, now they are in order of atomic __. (Mass number)9. - [Acquisition of a Brand](https://schoolworkhelper.net/acquisition-of-a-brand/) - Acquisition of a Brand An acquisition, also known as a takeover, is the buying of one company (the ‘target’) by another. An acquisition may be friendly or hostile. In the former case, the companies cooperate in negotiations; in the latter case, the takeover target is unwilling to be bought or the target's board has no - [Literary Devices and Social Injustice in Atonement the Movie](https://schoolworkhelper.net/literary-devices-and-social-injustice-in-atonement-the-movie/) - Literary Devices Parallelism- In the movie we are presented with injustice within an injustice. Robbie is accused and convicted of a sexual assault he did not commit. He is imprisoned and then sent to fight in World War II, which compromises his intentions of attending medical school and slandering his reputation. During his time serving - [The Role of the Teacher Answers](https://schoolworkhelper.net/the-role-of-the-teacher-answers/) - 1) In this essay the author is asserting the notion that "penny-pinching school boards” are the real ones to blame and not the teachers who are often the easiest to confront. The poor judgment and many cutbacks placed on teachers by their respective school boards create the appearance of mediocrity on the behalf of teachers. - [George Orwell’s: Politics and the English Language- Thesis and Analysis](https://schoolworkhelper.net/george-orwells-politics-and-the-english-language-thesis-and-analysis/) - The thesis of this essay can be divided into two portions which co-exist throughout the essay and are frequently used to support each other. In the introduction of the essay Mr. Orwell’s explains that modern English writers have a multitude of malicious tendencies which have been spread throughout all contexts of writing. He offers the - [Green Grass, Running Water Character Analysis](https://schoolworkhelper.net/green-grass-running-water-character-anaylsis/) - George Morningstar. Like the man who he alludes to, General Custer, George Morningstar posses an American patriotism that borderlines insanity. His zeal for American superiority blinds him to different perspectives on anything pertaining to challenging America’s supremacy. His brutal abuse of Latisha and undermining of Native traditions could be an analog to General Custer’s motives - [Othello Act 2, Scene I Translation (Lines 216- 303)](https://schoolworkhelper.net/othello-act-2-scene-i-translation-lines-216-303/) - Iago- Put your finger on your lips and silence yourself and listen to what I have to say. The excessive love which Desdemona has proclaimed for the Moor is only because of his bragging and fictitious stories. Do you really expect her to love him for his continual bragging? Surely in your heart, you can’t - [Gung Ho Movie Analysis](https://schoolworkhelper.net/gung-ho-movie-analysis/) - At the beginning of the movie, Oishi Kazihiro is in a training camp for failing executives. He has been a failure in his business career thus far because he is too lenient with his workers. He is tagged with countless banners and it is screaming particular phrases repetitively. This shows the dedication and rigorous conformity - [Song of Solomon Essay](https://schoolworkhelper.net/song-of-solomon-essay/) - Throughout Toni Morrison’s novel, Song of Solomon, many characters within the Michigan community of North side form relationships with each other. However too often, are the female characters in these relationships emotionally and physically abused or even abandoned by their male companions. Such abuse goes without reprimand and instead is instilled as heroism on the - [Trading between Canada and Jamaica](https://schoolworkhelper.net/trading-between-canada-and-jamaica/) - Canada and Jamaica enjoy close, longstanding, and historic bilateral relations that include hemispheric and international cooperation, security and defence cooperation, trade and investment links, official development assistance, tourism, and a large Jamaican community in Canada estimated at 230,000 people. Canada and Jamaica cooperate within the Commonwealth, the United Nations and the Organization of American States. - [“O”- Othello Movie Analysis and Summary](https://schoolworkhelper.net/o-othello-movie-analysis-and-summary/) - The reason why modernized versions of Shakespearean plays are so successful is that they take the brilliant works of Shakespeare and interpret their meanings and plots for modern audiences to enjoy. The sophisticated and eloquent writing structure used by Shakespeare in his plays often prevents the general populace from understanding the underlying imagery and significance - [Lab Exercise 6.1.1: Determining the Rate of Reaction](https://schoolworkhelper.net/lab-exercise-6-1-1-determining-the-rate-of-reaction/) - e) The reaction proceeds quite rapidly during the initiate mixture of Hydrochloric acid and Calcium Carbonate chips. Between 1-3 min the reaction is proceeding vigorously, however later on between 4-6 min the reaction tampers off and the consumption in HCl lowers per min intervals. Evaluation f) The experimental design appears to be very vague on - [Othello Act 3 Analysis and Summary](https://schoolworkhelper.net/othello-act-3-analysis-and-summary/) - Scene 1 The dialogue between the musicians and the clown acts as comical relief during the beginning of the play. After the very dramatic and heart-rending events which transpired during the purpose scene; Cassio drunken outburst and discharge and Iago revealing his sinister plan of exploitation and manipulation the play has transferred into an almost - [How will the world end?](https://schoolworkhelper.net/how-will-the-world-end/) - Today I had the opportunity to learn about the very “troubling” state of our solar system. Apparently there is a black hole located in the middle of our galaxy, and in the year 2012 the planet earth will the closest it has ever been to the black hole. So it begs the question of will - [Practical and Industrial Uses of Alcohols and Ethers](https://schoolworkhelper.net/practical-and-industrial-uses-of-alcohols-and-ethers/) - Alcohols Alcohols have a variety of uses in our everyday society because of how versatile of a functional group it is. Drink it One of the most commonly served beverages in the world, ethanol is consumed by millions of adults each years. Ethanol is commercially produced using a process called fermentation; this is the process - [Song of Solomon Monologue](https://schoolworkhelper.net/song-of-solomon-monologue/) - Introduction The Song of Solomon is Toni’s Morrison bestselling novel and the winner of the 1993 Noble Prize of Literature. The story transpires in an unnamed Michigan town from 1931 to 1963 and follows the life of, Macon Dead Jr, the youngest and only son of the richest black family of the North side community. - [Fallacies of Logic](https://schoolworkhelper.net/fallacies-of-logic/) - We have all used a fallacy of logical thinking during an argument, that I am certain of it. I have personally because the statement I just made was indeed a logical fallacy, Fallacy of Accident: A generalization that disregards exceptions. These endless list of potential logical fallacies are difficult to not only navigate and understand - [The Five Themes of Geography](https://schoolworkhelper.net/the-five-themes-of-geography/) - 1. LOCATION Position on the earth’s surface. There are two types of location: Absolute Location - a specific (exact) reference of something Examples: address, latitude and longitude, etc. Relative Location – description of where something is in relation to other things; approximation Examples: north of the lake, next to the school, etc. 2. PLACE Physical - [Types of Stars](https://schoolworkhelper.net/types-of-stars/) - Stars begin their lives as clouds of dust and gas called nebulae. The gravity of a passing star or the shock wave from a nearby supernova may cause the nebula to contract. Matter in the gas cloud will begin to coalesce into a dense region called a protostar. As the protostar continues to condense, it heats - [Sample Chemistry Unit Test](https://schoolworkhelper.net/sample-chemistry-unit-test/) - Part B: Thinking and Inquiry True or False – State whether each of the following statements is true or false. Replace the underlined words with the proper correction in the blank space provided, if the statement is false. (5 marks) the following statement will be something like these T or F Statement Correction The alkali - [Elements and Principles of Media Art](https://schoolworkhelper.net/elements-and-principles-of-media-art/) - The tools available to artists have increased and changed the ways we can create. In light of this, we have to find new ways to describe artwork. Earlier in the course we learned about the elements and principles of art and design. Now that we have had time to consider and use some of these - [Fundamental Vocabulary for Media Art](https://schoolworkhelper.net/fundamental-vocabulary-for-media-art/) - Objective Art: Art that includes recognizable subject matter. E.g. A painting of a landscape where the trees are easily recognizable. Non-objective Art: Art that does not include recognizable subject matter. Subject Matter: The theme/ object/ concept in a work of art. Very simply, what do you see? Focal Point: The area of artwork that catches - [What Ended World War One?](https://schoolworkhelper.net/what-ended-world-war-one/) - The year 1917 was a very important year for WWI. The war was truly a “world war”, with fighting taking place in Europe, Africa and Asia The Entrance of the United States Until 1917, the U.S. had maintained an “isolationist” position regarding WWI. This meant that they remained ISOLATED from participating in the conflict, choosing - [THE “HUNDRED DAYS” OFFENSIVE- World War One](https://schoolworkhelper.net/the-hundred-days-offensive-world-war-one/) - With the Russians out of the war, Germany had a renewed hope for success. They could now concentrate all their troops along the western front in France in their last attempt to win the war. With the entrance of the Americans into the war, the Germans realized that their last chance at victory was to - [THE TREATY OF VERSAILLES](https://schoolworkhelper.net/the-treaty-of-versailles/) - The Great War Comes to an End, 1918 Germany surrendered at 11 am on November 11th 1918. The country had run out of food, ammunition and public support for the war. The Kaiser, faced with revolution, abdicated and fled to Holland, which had been neutral during the Great War. With his departure, Germany became a - [Where was World One Fought- Theatres of WWI](https://schoolworkhelper.net/where-was-world-one-fought-theatres-of-wwi/) - Although World War One was a world war, most of the fighting was confined to a few key areas. These areas are usually referred to as the theatres of war. Western Front The German army crossed the Belgian border on August 3rd, 1914. Britain and France declared war on Germany on August 4th. The Germans - [THE CONSCRIPTION CRISIS OF 1917](https://schoolworkhelper.net/the-conscription-crisis-of-1917/) - In 1917, Prime Minister Borden travelled to the frontlines in Europe to visit the soldiers. Here, he is informed that the war is expected to last until 1920. Like most British Canadians, Borden was committed to support the British Empire, and wanted to send more troops overseas to fight. PROBLEM: there were more casualties than - [How to Write a Formal Laboratory Report](https://schoolworkhelper.net/how-to-write-a-formal-laboratory-report/) - The laboratory report is a permanent record of your work in the lab. Of first importance is the requirement that the write-up be an honest record. Failures,as well as successes, should be faithfully recorded. I. GENERAL ORGANIZATION: TITLE PAGE - The general layout MUST look EXACTLY like the following example: Complete Title of Lab Name: - [How House of Commons Works](https://schoolworkhelper.net/how-house-of-commons-works/) - House of Commons Place where issues affecting everyone in the country will be discussed and debated. Through discussion and debate, your elected Members of Parliament will attempt to direct your nation Passing a bill will require a majority vote in favor of it, but when bills do become laws, every citizen in your nation must - [FACTORS THAT AFFECT RATES OF REACTION](https://schoolworkhelper.net/factors-that-affect-rates-of-reaction/) - The Kinetic Molecular Theory states that matter is made up of particles that are always in constant motion and that the particles move more quickly at higher temperatures. From this theory came the COLLISION MODEL for chemical reactions. According to the collision model there are two ways to make a chemical reaction go faster: 1) - [Of Mice and Men Background Information](https://schoolworkhelper.net/of-mice-and-men-background-information/) - Setting: Steinbeck’s novel deals with the plight of migrant labourers in California during the Great Depression. Characters: the focus is on two migrant workers, George and Lennie Chapter 1 – establishes relationship between the two primary characters George – a rational realist Lennie – simplistic and child like George cares for Lennie, consistently scolds and - [The Spread of Imperialism](https://schoolworkhelper.net/the-spread-of-imperialism/) - The generation between 1880 and 1914 witnessed a unprecedented outburst of European empire building USA was a part of it too A period of highly competitive colonization 4/5ths of Earth’s surface was under European or USA control A few cases of successful resistance, but they were scattered and very few By 1914, the domination of - [Louis the XIV: King & History](https://schoolworkhelper.net/louis-the-xiv/) - When Louis XIV came to the throne as a five-year-old boy (actually four years, eight months) on 14 May 1643, the Thirty Years' War was still in progress, and Cardinal Richelieu, the French éminent grise, had died the preceding year. The situation did not look good for France, but the young boy became one of - [How to submit work to turnitin.com](https://schoolworkhelper.net/how-to-submit-work-to-turnitin-com/) - To start using Turnitin, go to http://www.turnitin.com and log in using the following information: Click on NEW USER in the top right corner of the page. Click on CREATE A USER PROFILE Click on STUDENT in the Create a New Account box Enter the following information: (EXAMPLE INFO- Your Teacher will provide this) Class ID - [Criminal Law: the Process](https://schoolworkhelper.net/criminal-law-the-process/) - We know when a crime exists (actus reus and mens rea), so what happens after a crime has been committed? THE LEVELS OF POLICE IN CANADA Federal – RCMP – responsible for all federal law under the Criminal Code and federal regulations Provincial Police Municipal Police Aboriginal Police DETERMINE THE PARTIES INVOLVED The perpetrator (the - [Ancient Israel: History & Events](https://schoolworkhelper.net/ancient-israel/) - Ancient Israel is the birthplace of the 3 great monotheistic religions of the world: Judaism, Christianity and Islam Ancient Israel dates back approximately 4000 years to the books of the Old TestamentGreat patriarchs of Judaism: Abraham, Jacob, Moses, Joshua Hebrews, Israelites, Jews, Semites: have all undergone persecution throughout history; from Babylonian Captivity, Exodus, Diaspora, Spanish - [Socio-Political Philosophy](https://schoolworkhelper.net/socio-political-philosophy/) - Introduction, Purposes and Approaches Social and political philosophers are concerned with defining and interpreting concepts like justice, freedom, authority and democracy in a modern context as well as in the past. These two branches of philosophy overlap so much they are usually treated as one area of philosophy. If there is an actual difference it - [How to make a Good Thesis Statement](https://schoolworkhelper.net/how-to-make-a-good-thesis-statement/) - A thesis statement declares what you believe and what you intend to prove. A good thesis statement makes the difference between a thoughtful research project and a simple retelling of facts. A good tentative thesis will help you focus your search for information. But don't rush! You must do a lot of background reading before - [CELL-MEDIATED IMMUNE RESPONSE](https://schoolworkhelper.net/cell-mediated-immune-response/) - Complement Protein: special proteins that expand/puncture the pores in membranes on foreign microbes allowing extracellular fluid to rush in and lyse the cells, thus killing them. Lymphocytes: specialized white blood cells T-cells: produced in the bone marrow and stored in the thymus. Act in a seek and destroy fashion by recognizing the antigen markers on - [BIOLOGICAL MOLECULES](https://schoolworkhelper.net/biological-molecules/) - Biological molecules are macromolecules, which basically means they are polymers composed on small repeating units that have been covalently bonded together. The exception to this is a type of lipid called triacyleglycerides or phospholipids which are relatively large molecules composed of smaller molecules bonded together. Subunits are chemically liked together in the cell by a - [How to Name Hydrocarbons (IUPAC)](https://schoolworkhelper.net/how-to-name-hydrocarbons-iupac/) - NAMING HYDROCARBONS HYDROCARBON DESCRIPTION GENERAL FORMULA Alkane (-ane ending) Only single bonds (C—C) CnH2n + 2 (linear) CnH2n (cycloalkane) Alkene (-ene ending) At least one double bond (C=C) CnH2n Alkyne (-yne ending) At least one triple bond (C=C) CnH2n-2 Interesting fact: a double bond is more reactive than a single bond as the second covalent - [Valence Shell Electron Pair Repulsion (VSEPR) Theory](https://schoolworkhelper.net/valence-shell-electron-pair-repulsion-vsepr-theory/) - Valence shell electron pair repulsion (VSEPR) theory is a model in chemistry used to predict the shape of individual molecules based upon the extent of electron-pair electrostatic repulsion. It is also named Gillespie-Nyholm theory after its two main developers. The premise of VSEPR is that the valence electron pairs surrounding an atom mutually repel each - [ORGANIC REACTIONS](https://schoolworkhelper.net/organic-reactions/) - To simplify the multitude of possible combinations of reactants, organic reactions fall under specific types. Combustion Substitution Addition Elimination Oxidation/reduction Condensation (dehydration synthesis) Hydrolysis (hydration) Polymerization Another tool to simplify your task of predicting products is to remember that functional groups will always react the same way. e.g. all 1o alcohols will react the same - [PROTEINS](https://schoolworkhelper.net/proteins/) - Proteins in the human body have a wide range of functions which include: Hormones (insulin, testosterone), Muscle Fibers (actin, muasin), Carrier Protein (Oxygen carrying hemoglobin), Structure/ Support (nails/ hair), Enzymes (biological catalyst), Membrane Transport (Na/ K pump), Cell-to-Cell Recognition, Antibodies. Structure Proteins are polymers made up of amino acid subunits bonded together by peptide bonds. - [NUCLEIC ACIDS: DNA and RNA](https://schoolworkhelper.net/nucleic-acids-dna-and-rna/) - Nucleic acids are the storage form of all the genetic information required by a cell. They also are the cell’s preferred energy molecule ATP as well as acting as being used as intermediate electron carrier molecules in cellular respiration in the form of NAD+ (nicotinamide adenine dinucleotide) and FAD (flavin adenine dinucleotide). cAMP (cyclic adenosine - [Canadian Politics in the 1940’s, 1950’s and 1960’s](https://schoolworkhelper.net/canadian-politics-in-the-1940s-1950s-and-1960s/) - Post World War II was a time of incredible political change in Canada MacKenzie King In 1945, the C.C.F. was becoming popular. King, the P.M. and leader of the Liberal party, wanted to find a way to “steal their thunder” and strengthen his party’s hold on Canadian politics. He introduced unemployment insurance to give unemployed - [Snell’s Law Questions/ Answers](https://schoolworkhelper.net/snells-law-questions-answers/) - Indices of Refraction for Various Media: 1. Using Snell’s law, determine the constant when the angle of incidence and the angle of refraction are: a) 50˚ and 30˚ b) 30˚ and 18˚ c) 60˚ and 38˚ 2. a) What is the angle of refraction in a medium if the angle of incidence in air is - [Lab Safety Rules](https://schoolworkhelper.net/lab-safety-rules/) - The laboratory is a safe place to experiment if you are careful and familiar with all the equipment. You must assume responsibility for the safety of yourself and your neighbours. This paper outlines the steps to use for safety and first aid in this classroom. Student bags or backpacks and coats are not permitted in - [Cardinal Richelieu: Political Testament, 1624](https://schoolworkhelper.net/cardinal-richelieu-political-testament-1624/) - At the time when your Majesty resolved to admit me both to your council and to an important place in your confidence for the direction of your affairs, I may say that the Huguenots shared the state with you; that the nobles conducted themselves as if they were not your subjects, and the most powerful - [PERSIA-GT](https://schoolworkhelper.net/persia-gt/) - An academic thinker named Edward Fenton came up with the acronym PERSIAT. He wanted to find a way to structure intellectual analysis so that concepts and subconcepts could be quickly and properly classified. In the last few years, Fenton’s original concept has been expanded upon and the idea of Geographical analysis has been added. Currently, - [The Canadian Charter of Rights and Freedoms](https://schoolworkhelper.net/the-canadian-charter-of-rights-and-freedoms/) - Schedule B, Part I of the Constitution Act, 1982, comprises the Charter. Section 52: the Charter is a part of the Constitution which is the supreme law of Canada and all laws must comply with it. Charter can only be altered through the amending formula – substantial consensus of all the provinces and the federal - [Justice: Law's Supreme Value](https://schoolworkhelper.net/justice-laws-supreme-value/) - The most basic and important ideal of our legal system is justice. There are two dimensions of justice. These are formal justice and substantive justice. Formal Justice: Requires decisions be made in a non-arbitrary and consistent manner Established legal rules must be followed No person shall be regarded to be above the law Every person - [Origins of Law](https://schoolworkhelper.net/origins-of-law/) - SIGNIFICANT PERSON OR CONCEPT DEFINITION, OR IMPORTANCE TWO EXAMPLES HAMMURABI (POSITIVE LAW AS MADE BY A PERSON) Codification Retribution (eye for an eye) Patriarchal All Babylonians Subject to the law King is above the law Very harsh and cruel Son gets hand cut off if strikes father, not mother Doctor gets hand cut off if - [Aboriginal Rights](https://schoolworkhelper.net/aboriginal-rights/) - Aboriginal Rights: Collective rights rooted in historic cultural traditions and practices, based on ancestral use of the land. Rights as distinct peoples recognized in law and treaties Collective Rights: Rights held through membership to a group. All members have same rights. Areas of Concern: Self-government Land ownership Control of natural resources The Royal Proclamation, 1763 - [Types of Legal Defenses](https://schoolworkhelper.net/types-of-legal-defenses/) - Legal Defenses • Insanity • Automatism • Intoxication • Duress • Self-Defense • Alibi • Necessity • Mistake of Fact • Provocation • Officially induced error • Entrapment • Double Jeopardy Insanity • Accused cannot perform the Mens Rea of the offence or is not fit to stand trial. To Prove Insanity you must: • - [Historical Methods of Adjudication](https://schoolworkhelper.net/historical-methods-of-adjudication/) - Trial by Wager Required the accused to have a number of acquaintances (oath-helpers) swear his/ her innocence Not applicable to people caught in the act or with stolen property. They faced one of the following: Trial by Battle Evolved from Anglo-Saxon practice of "blood feud" where relative of victim tool revenge by attacking killer and - [Types of Legal Evidence](https://schoolworkhelper.net/types-of-legal-evidence/) - Direct Evidence: the testimony of witnesses who actually saw the offence being committed Circumstantial Evidence: indirect evidence; indicates that it is highly probable that the accused is the only one who could have committed the crime Similar Fact Evidence: shows that the accused has committed similar offences in the past Hearsay Evidence: something that someone - [Human Rights](https://schoolworkhelper.net/human-rights/) - 1948 UN General Assembly adopted the Universal Declaration of Human Rights. Outlines basic human rights including: The right to life, liberty and nationality Freedom of opinion, conscience, and religion Right to work Right to an education Right to take part in the nation’s public business 1966 United Nations Convention on Economic, Social and Cultural Rights - [International Law](https://schoolworkhelper.net/international-law/) - Customs, rules, and agreements that govern relations between sovereign states. More recently also includes handling such matters as human rights within the borders of sovereign nations. Is international law real law? Domestic Law Vs. International law No international legislature passing laws – UN closest to such a forum No comprehensive judicial system – International Court - [What is Harassment?](https://schoolworkhelper.net/what-is-harassment/) - Protected groups have the explicit right to freedom from harassment in housing accommodation and employment. The Code defines harassment as “engaging in a course of vexatious [annoying or provoking] comment or conduct which is known or ought reasonably to be known to be unwelcome.” The most important word in the definition is “unwelcome.” We do - [Comparing lac and trp Operons](https://schoolworkhelper.net/comparing-lac-and-trp-operons/) - lac Operon Model Regulates production of enzyme B-galactosidase which is needed to break down lactose. It consists of a cluster of 3 genes under the control of one promoter and one operator. When lactose levels are low the LacI repressor protein binds to lac operator, covering part of the promoter region which blocks transcription of - [ENTROPY](https://schoolworkhelper.net/entropy/) - Entropy, S, is the tendency towards randomness or disorder in a system - an ordered arrangement of particles has a lower entropy/disorder than the same number of particles in random arrangements Entropy becomes more disordered with: 1.) ^ Temperature – more chaotic motion 2.) ^ Volume of gases 3.) change in phys. State A change - [The Chaser- John Collier](https://schoolworkhelper.net/the-chaser-john-collier/) - Alan Austen, as nervous as a kitten, went up certain dark and creaky stairs in the neighborhood of Pell Street, and peered about for a long time on the dime landing before he found the name he wanted written obscurely on one of the doors. He pushed open this door, as he had been told - [SHORT STORY TERMS](https://schoolworkhelper.net/short-story-terms/) - 1. Plot: is what happens in the story; the sequence of events 2. Plot Pattern: a) Introduction: Explains the situation, introduces setting, introduces characters b) Rising Action: The series of increasingly suspenseful complications and events c) Climax: The point at which one force in the main conflict wins over the other force in the main - [A Plate Tectonics Flip Book Answers](https://schoolworkhelper.net/a-plate-tectonics-flip-book-answers/) - Around 190 million years ago, Pangaea began to break up. The breakup resulted in two landmasses: Laurasia, the northern group of continents, and Gondwanaland, the southern group of continents; Gondwanaland included South America, Antarctica, Australia, Africa, and India. Breakups! North America: 130 mya Australia: 50 mya India: 90 mya Europe: 30 mya Antarctica: 50 mya - [Chapter 4 LAB Activity: Eratosthenes and the Earth’s Circumference Answers](https://schoolworkhelper.net/chapter-4-lab-activity-eratosthenes-and-the-earths-circumference-answers/) - Introduction Eratosthenes, a Greek geographer (about 276 to 194 B.C.), made a surprisingly accurate estimate of the Earth's circumference. The legend follows that Eratosthenes used a deep vertical well near Syene, in southern Egypt which was entirely lit up by the sun at noon once a year as the basis of his calculations. He reasoned - [Deciphering Tree Rings Answers](https://schoolworkhelper.net/deciphering-tree-rings-answers/) - 1) There appears to be a negative correlation between the tree ring growth and the average temperature for each year. As the temperature declines the average tree ring growth becomes much more substantial and vice versa when the temperature increases. Examples of this correlation can be seen at several yearly intervals such as: High Tree - [Environmental Values and Ethics](https://schoolworkhelper.net/environmental-values-and-ethics/) - Utilitarian Justification- conservation of nature is important because the environment, ecosystem, habitat, or species provides individuals (aka humans) with direst economic benefits. Ecological Justification- conservation of nature is based on the knowledge that a species, ecological community, ecosystem, or the Earth’s biosphere provides specific function necessary to the persistence of our life. Aesthetic Justification- conservation - [What is Suburban Sprawl?](https://schoolworkhelper.net/what-is-suburban-sprawl/) - Suburban sprawl is resulting in the increased consumption of fossils fuels in order for individuals to commute to and from their homes and work. This increased demand of fossil fuels will further deplete our already declining oil reserves, resulting in a cost increase. This will make living conditions for humans much more difficult and potentially - [Gaia Hypothesis](https://schoolworkhelper.net/gaia-hypothesis/) - The Gaia hypothesis formulated by James Lovelock in the late 1960s presents the notion that our planet is a single self-managing organism which regulates the conditions necessary for life. After its publication in James Lovelock’s book “Gaia: A new look at life on Earth” it revolutionized the perspective of Earth as a “living being” and - [Industrial Melanism and the Peppered Moth Lab Answers](https://schoolworkhelper.net/industrial-melanism-and-the-peppered-moth-lab-answers/) - Table 1: Amount of Light/ Dark moths remaining before, during, after industrial revolution Tree Bark # of Melanic Moths Remaining # of Light Moths Remaining % of Melanic Moths Remaining (/30) % of Light Moths Remaining (/30) Light (Pre-Industrial Revolution) 1 13 13 43% 43% 2 10 15 33% 50% 3 8 16 27% 53% - [Fun-Filled Fitness Challenge Lab Answers](https://schoolworkhelper.net/fun-filled-fitness-challenge-lab-answers/) - Experiment #1: Muscle Fatigue a) Graphic 1: Comparison of Finger pinches over 20s intervals for both hands As the lab progressed, the strength of my fingers degraded through each successive trial. This resulted in the numbers of pinches I made with either hand to decrease, which was anticipated due to muscle fatigue. At the end - [Urine Analysis Lab Analysis Answers](https://schoolworkhelper.net/urine-analysis-lab-analysis-answers/) - Sample B indicates diabetes mellitus. Diabetes mellitus is caused by inadequate secretion of insulin from islet cells in the pancreas, which causes sugar levels to rise. People suffering from this disease will have higher blood sugar concentrations which remain in the nephrons and this is detected in their urine. This correlates with sample B result - [Floodplains and Floods (Manitoba Flow 1997)](https://schoolworkhelper.net/floodplains-and-floods-manitoba-flow-1997/) - A flood occurs when a river overflows and due to environmental and/or human features and water flows onto the land surrounding it; also known as the floodplain. A floodplain is the flat piece of land found beside and surrounding a stream or river that will be periodically flooded. Its features a floodway, which consists of - [Earthquake: Shadow Zones](https://schoolworkhelper.net/shadow-zones/) - As the distance to the epicenter increase, the time delay between the P and S wave arrivals increases as well. The greater the distance from the epicenter the more progressively the S wave will lag behind the P wave. P waves (primary waves) are longitudinal waves that travel through the earth. When placed in solid/ - [Total Internal Reflection](https://schoolworkhelper.net/total-internal-reflection/) - A good example of total internal reflection is a diamond. Diamond has the highest index of refraction but can increase the amount of total internal reflection by being cut properly making diamond sparkle. Critical angle: this is angle of incidence that produces an angle of refraction equal to 90 degrees If the angle of refraction - [TRANSITION WORDS](https://schoolworkhelper.net/transition-words/) - To improve your writing you need to make sure that your ideas, both in sentences and paragraphs, stick together or have coherence and that the gap between ideas is bridged smoothly. One way to do this is by using transitions - words or phrases or techniques that help bring two ideas together. Transitional words and - [THE HERO’S JOURNEY- by Joseph Campbell](https://schoolworkhelper.net/the-heros-journey-by-joseph-campbell/) - Campbell explores the theory that important myths from around the world that have survived for thousands of years all share a fundamental structure, which Campbell called the monomyth. This fundamental structure contains a number of stages, which include: First, the hero is often born in mysterious circumstances, or undergoes a serious life challenge early on. - [English Literary Terms & Definitions](https://schoolworkhelper.net/literary-terms/) - Allegory: Hidden meaning, typically a moral or political one. Alliteration: The occurrence of the same letter or sound at the beginning of adjacent or closely connected words. Ex: Alice’s aunt ate apples and acorns around August. Analogy: Comparison in which an idea or a thing is compared to another thing that is quite different from - [Common Errors in your Essay/Paragraph Writing](https://schoolworkhelper.net/common-errors-in-your-essayparagraph-writing/) - 1. Stylistic/Technical Mistakes a. Italicize the title of a major work (novel, play, movie)Example: The Merchant of Venice(if you are writing it out, you underline the title)b. Put the title of short works in quotation marks (essays, short stories, poetry) Example: “The Fall of a City”)c. Structural Continuity• The way your thesis is written dictates - [How to format Shakespearian quotations](https://schoolworkhelper.net/how-to-format-shakespearian-quotations/) - There are three main ways to quote from Shakespeare properly. See the format below depending on how much of the play you are quoting. This is also done in proper MLA format. CITATION EXAMPLE – a quotation where more than one person speaks: …An early example of this lies in Viola/Cesario’s first meeting with Olivia. - [Debate Structure & Etiquette](https://schoolworkhelper.net/debate-structure-etiquette/) - • Introductions should precede the debate.• The debater should not offer emotional appeals. H/she should concentrate on the evidence.• The debater should never falsify, create or distort evidence.• The debater should never publicly disagree with the decision of the judge or the audience. Winners need to be congratulated by the opposition.• Debaters should not insult, - [Essay Analysis Structure](https://schoolworkhelper.net/essay-analysis-structure/) - 1. Type of essay: Narrative To entertain, illuminate, or tell a story Argumentative To convince the reader of the validity of the thesis Persuasive To persuade the reader to act Expository To explore, explain, classify, or define 2. Purpose: What is the thesis? Explicit or Implicit? What is the purpose of the essay? (to entertain, - [How to Write a Formal Analytical Essay](https://schoolworkhelper.net/how-to-write-a-formal-analytical-essay/) - 1.INTRODUCTION 3 Sentences (suggested minimum)The first sentence introduces the topicThe second sentence identifies the author and novelThe third sentence states the thesis2.BODY 2 paragraphs (suggested minimum)Each paragraph based on one aspect of the thesisParagraphs linked to one another with a connecting word or phrase (transition)Paragraphs are written in a formal analytical styleParagraphs follow the pattern: - [Incorporating Quotations into Essays](https://schoolworkhelper.net/incorporating-quotations-into-essays/) - Quotations are the most convenient method of providing proof in an academic essay. They may range in length from one word to several lines. There are conventions and rules that MUST be followed when you integrate quotations into your essay. Short quotations should be made part of your own sentences and enclosed in quotation marks - [Where are Active Volcanoes?](https://schoolworkhelper.net/where-are-active-volcanoes/) - Volcanoes formed at certian locations because they were along plate boundaries, which provide the ideal circumstances for magma formation and its subsequent eruption. At subduction boundaries the lithopsheres collide and the denser plate is pulled down into the mantle. This introduces water into the asthenosphere which lowers melting temperature and allows the less dense magma - [Julius Caesar Act I & II Summary](https://schoolworkhelper.net/julius-caesar-act-i-ii-summary/) - ACT I SCENE 1 On February 15, the Feast of Lupercal, the people of Rome celebrate Caesar's victory over Pompey in a civil war. Marullus and Flavius, two government officials who support Pompey, attempt to discourage celebrating workers. SCENE 2 On the same day, Caesar attends the traditional race at the festival of Lupercal and - [Canada at the Turn of the Century](https://schoolworkhelper.net/canada-at-the-turn-of-the-century/) - Canada became a nation in 1867 and like all new countries faced several important challenges. Wilfrid Laurier became Prime Minister in 1896 and stayed in office until 1911, so he had to take responsibility for many of those challenges. Demographics: In 1900, Canada was mostly a rural society. People worked as farmers, fishers, loggers, fur - [How to do a Bibliography](https://schoolworkhelper.net/how-to-do-a-bibliography/) - Items in a bibliography are alphabetically ordered by author; and, if no author, then by title. Looking at the examples below, the source authored by the Central Intelligence Agency would be listed before the source titled "How to Measure Justice". The source titled "Vietnam" would be last in order and the source by George Adams - [CANADA'S CALL TO ARMS](https://schoolworkhelper.net/canadas-call-to-arms/) - When England declared war, Canada knew that we too would be involved in the fighting. The tone was excited, everyone thought the war would be over by Christmas. Most people felt it was their duty to help Canada (Britain) achieve her goals any way they could. Many young men enlisted in the army. Pacifists are - [Long Term Causes of World War One](https://schoolworkhelper.net/long-term-causes-of-world-war-one/) - The long term (ones that were going on for a long time) causes of World War One can be easily remembered by the acronym MAIN M – Militarism When a country builds up their military force. By 1914, Germany and Britain were building up their navies, and France and Germany were building up their armies - [The Home Front – How Canadians at Home supported the War](https://schoolworkhelper.net/the-home-front-how-canadians-at-home-supported-the-war/) - On December 7, 1917, Canadian newspapers told the grim news of the Halifax Explosion "the dead piled high at morgues in Halifax". 2000 dead because a ship carrying weapons and ammunition exploded in the Halifax harbour. This event brought the war to Canadian shores, but Canadians were all involved in the fight well before this. - [Types of Irony](https://schoolworkhelper.net/types-of-irony/) - 1. Verbal Irony: This occurs when a character says one thing but suggests or intends the opposite. For example, in Julius Caesar, Mark Antony says “and Brutus is an honorable man,” when he really means that Brutus is dishonorable because he has betrayed Caesar. Very similar to sarcasm, although sarcasm is harsh and direct while - [Air and Sea battles in World War I](https://schoolworkhelper.net/air-and-sea-battles-in-world-war-i/) - Airplanes were used for the first time in war during World War One. The first planes were very flimsy and were made of only a wood frame and they were covered in canvas. The parachute had not yet been invented, and the engines would often stall. The airplanes' main purpose was to photograph enemy positions - [Types of Sentence Structures](https://schoolworkhelper.net/types-of-sentence-structures/) - Simple: Contains a subject and a verb and is a complete thought (independent clause) (He ate an apple) Compound: Contains two independent clauses combined with a coordinator. (He ate an apple and walked to school) Complex: Contains an independent clause and a dependent (can not be on its own) clause. (He ate an apple after - [The Stock Market Crash](https://schoolworkhelper.net/the-stock-market-crash/) - The good life came to an abrupt end in the late 1920s. Here are some of the reasons why: Overproduction of goods, especially in the US. The US raised its tariffs on imported goods, which made Canadian goods undesirable in their large market. Britain and other European countries also increased tariffs. Too much competition in - [The Struggle For Power in Europe (1918-1930s)](https://schoolworkhelper.net/the-struggle-for-power-in-europe-1918-1930s/) - In one way, losing in World War I could have been a blessing in disguise for Germany. For centuries before World War I, Germans had been ruled by the wealthy noble minority, the dukes and princes in the country. This nobility had not wanted to lose its power, so they had never allowed the German's - [CARBON MONOXIDE THREAT IS NOT A MYTH](https://schoolworkhelper.net/carbon-monoxide-threat-is-not-a-myth/) - Over the last few years, the issue of carbon monoxide (CO) poisoning in the home has become much more of a public safety issue. Carbon monoxide detectors first came onto the market in the early 1990s. CO detectors have not made the problem of CO contamination go away. They can’t stop CO from leaking. It - [Key Changes of Renaissance and Reformation](https://schoolworkhelper.net/key-changes-of-renaissance-and-reformation/) - Charles V (24 February 1500 – 21 September 1558) was ruler of the Holy Roman Empire from 1519 and, as Charles I of Spain, of the Spanish realms from 1516 until his abdication in 1556. As the heir of four of Europe's leading dynasties – the Habsburgs of Austria, the Valois of Burgundy, the Trastamara of Castile and the House of Aragon – he ruled over extensive domains in Central, Western and Southern Europe, as well as the various - [Body Adornment (Piercings, Tattoos)](https://schoolworkhelper.net/body-adornment-piercings-tattoos/) - Body modification and ornamentation can be found the world over. It has been used in rites of passage, spiritual rites, and to enhance beauty. The adornment of the body takes on many forms, such as body painting, hair styling, tattooing, scarification (decorative scarring), and piercing. The delivery of each culture’s customs regarding body modification and - [What is Anthropology?](https://schoolworkhelper.net/what-is-anthropology/) - Anthropology: The study of the lives and cultures of humans alive or dead. Anthropologists: Use reason to gain knowledge and insight into human kind Examine how humans live, think, communicate, produce and interact with their social and physical environment Study how different people can be and how much different people have in common Physical Anthropology: - [What is Cultural Anthropology](https://schoolworkhelper.net/what-is-cultural-anthropology/) - Cultural anthropology is the study of how culture shapes human ideas and learned behaviours. It examines how cultures have developed and compares similarities and differences among them. Cultural anthropologists base their knowledge on observation. They try to be objective and draw conclusions from data, without imposing their own personal judgments. Many times anthropologists are faced - [What is Branding and Positioning](https://schoolworkhelper.net/what-is-branding-and-positioning/) - BRANDING AND POSITIONING PACKAGING Who packages the items? Raw material processors, manufacturers, retailers Why and how are things packaged? Protection Convenience Information Environmentally Friendly Promotion Appearance and Branding Packaging is often referred to as “THE SILENT SALESPERSON” 6 FUNCTIONS OF PACKAGING Protection Protect from breakage (bubble wrap, foam) Protect from germs, air, sunlight, dust/dirt (air - [Pricing Strategies](https://schoolworkhelper.net/pricing-strategies/) - Cost-plus Pricing - A markup is added to the cost price to ensure a profit Markup = selling price - cost price Markup % = selling price - (cost price/cost) X 100 Follow-the-competition Pricing - The price of the product or service is set equal to or slightly below a competitor's price. The pricing can - [Paragraph Structure and Types](https://schoolworkhelper.net/paragraph-structure-and-types/) - A paragraph is a unit of writing that consists of one or more sentences focusing on a single idea or topic. A well-written paragraph often has the following structure: Topic Sentence: This sentence outlines the main idea that will be presented in the paragraph. Support Details or Examples: This is the part of the paragraph - [ROMEO AND JULIET ACT 2, SCENE 2 IMAGERY](https://schoolworkhelper.net/romeo-and-juliet-act-2-scene-2-imagery/) - Imagery is the use of descriptive language to create an image in the minds of the readers. Shakespeare uses many kinds of images in his play. Here are 4 kinds of imagery we find frequently in Romeo and Juliet: Metaphor: describing something by comparing it to something else without the use of “like” or “as” - [Character Development in a Story](https://schoolworkhelper.net/character-development-in-a-story/) - From the stories you have read so far, it is clear that for a plot to exist, it must have characters, or people created by the author. Although these people are fictional, they must be believable and arouse your sympathy or interest if the story is to hold your attention. Every author, in his own - [What is Voice, Audience and Purpose](https://schoolworkhelper.net/what-is-voice-audience-and-purpose/) - Voice: is the manner in which a story is told so as to connect to readers on an emotional level or the author’s point of view. For example, the author speaks directly in his or her own person or a role or speaks through a persona. Audience: the people for whom the audience is written. - [What is Setting?](https://schoolworkhelper.net/what-is-setting/) - The setting of a story is the time and place in which the events occur. Think of a movie or TV show that you have watched recently. Was the story about people today or about people from the past or future? How did you recognize the time period? Did the characters’ clothing, hairstyles, and speech - [What is Character, Tone, and Mood?](https://schoolworkhelper.net/what-is-character-tone-and-mood/) - Character Getting to know the characters in a story is like becoming acquainted with a person you have just met. It takes a little more time to learn what the person is like. You learn from what others say about the person. Motivations Motivations are the reasons characters behave the way they do. Notice what - [What is Plot and Sequence?](https://schoolworkhelper.net/what-is-plot-and-sequence/) - Plot and Sequence Fiction includes novels, short stories and other writings that tell about imaginary people and events. The plan or main story in a piece of fiction is called the plot. Understanding the order of events in a plot is important when you are reading. You probably expect the narrator, or storyteller, to start - [Laws of Chemical Change](https://schoolworkhelper.net/laws-of-chemical-change/) - Observations of chemical reactions are summarized in certain generalizations called the laws of chemical change. The three laws of chemical change are; 1) Law of Conservation of Mass 2) Law of Constant Composition 3) Law of Multiple Proportions Law of Conservation of Mass States that during a chemical reaction, matter is neither created or destroyed - [The Human Circulatory System](https://schoolworkhelper.net/the-human-circulatory-system/) - Functions: 1. transport oxygen and carbon dioxide 2. distribute nutrients and transport of wastes 3. maintenance of body temperatures 4. circulation of hormones Structure: Made up of three components: 1. A fluid in which materials are transported (blood) 2. vessels in which the fluid moves (blood vessels) 3. a pump (the heart) Circulatory system is - [Mitosis and the Cell Cycle](https://schoolworkhelper.net/mitosis-and-the-cell-cycle/) - Genetic continuity is the transmission of hereditary material through cell division. The Cell Cycle - cells do not divide continuously- in cells capable of dividing, the period between cell divisions is called interphase- cells spend most of their time in interphase because this is the phase where they perform their functions (obtaining energy, synthesizing products, - [Cell Membrane Function and Structure](https://schoolworkhelper.net/cell-membrane-function-and-structure/) - The plasma membrane surrounds the cell and is crucial to cell life: it must control what enters and leaves the cell. It must allow sufficient amounts of food molecules, such as glucose, to pass into the cell and must also allow for the quick removal of waste products from the cell. Membrane Structure Phospholipids Most - [Cell Reactions and Energy](https://schoolworkhelper.net/cell-reactions-and-energy/) - Cells must perform thousands of different chemical reactions in order to survive. These reactions are crucial to providing cells with energy. Endergonic reactions: -“energy in” require energy in order to proceed - biological endergonic reactions produce molecules that store energy (ex. Glucose) - Ex. Photosynthesis Exergonic reatctions: - “energy out” release energy - biological exergonic - [CELLULAR RESPIRATION](https://schoolworkhelper.net/cellular-respiration/) - Energy - needed for: - movement - synthesis of complex compounds - active transport Food - provides energy needed by cells - broken down > heat (body heat, excess removed) chemical storage form Cellular Respiration - is the process by which chemical energy stored in food (usually glucose, but may be protein and lipids is - [The Chemical Basis of Cells: Biochemistry](https://schoolworkhelper.net/the-chemical-basis-of-cells-biochemistry/) - The atom is the basic unit of matter. Atoms bond to one another to form compounds. Bonds are formed by the sharing or transfer of electrons present in the atoms. Bonds between Atoms: Chemical Bonds Covalent compounds - formed by the EQUAL sharing of electrons between atoms - electrically neutral molecules (no “+” or “-“ - [Blood: Structure, Function, Components](https://schoolworkhelper.net/blood-structure-function-components/) - Components: i) plasma ii) erythrocytes (red blood cells) iii) leukocytes (white blood cells) iv) platelets Plasma: o 55% of blood volume and is 90% water o Contains dissolved materials which are being transported: o proteins (fibrinogen), hormones, nutrients, waste products, gases Erythrocytes: o Function: > to carry oxygen o Structure: > no nucleus, cytoplasm contains - [The Digestive System: Function and Structure](https://schoolworkhelper.net/the-digestive-system-function-and-structure/) - Function of the Digestive System: To change foods you eat into chemical forms your body can use and eliminate anything that can not be used by your body. Food is typically in a form that is completely unsuitable for use by body cells. Food becomes useful only after it has been converted into smaller, simpler - [Organs of the Digestive Tract](https://schoolworkhelper.net/organs-of-the-digestive-tract/) - Liver - produces bile -bile emulsifies fats in the small intestine; increases surface area of fat particles Gall Bladder - stores bile between meals - releases bile when food moves into the small intestine Pancreas - manufactures and releases bicarbonate to neutralize acid coming out of the stomach - basic environment inactivates pepsin - releases - [Characteristics & Chemistry of Life](https://schoolworkhelper.net/characteristics-chemistry-of-life/) - Matter makes up everything, everywhere. All matter, both living and non-living, is composed of miniature chemical building blocks called atoms. Your body contains billions of hydrogen, oxygen, nitrogen, phosphorus, sulfur and carbon atoms. What is life? What does it mean to be alive? How is something made “living”? There is no universal agreement on what - [Classification Level: Kingdom](https://schoolworkhelper.net/classification-level-kingdom/) - The table below lists the basic general characteristics that are used to differentiate between the different kingdoms. Criteria Kingdom Animals Plants Fungi Protists Archaebacteria Eubacteria Type of cells Eukaryotic Eukaryotic Eukaryotic Eukaryotic Prokaryotic Prokaryotic Cell wall None Yes (cellulose) Yes (chitin) None Yes (peptidoglycan) Yes Cell organization Multicellular Multicellular Multicellular Single celled Single celled Single - [Eukaryote vs. Prokaryote](https://schoolworkhelper.net/eukaryote-vs-prokaryote/) - Below is a table that compares the differences in cell structure between eukaryotic and prokaryotic cells. Criteria Type of Cell Prokaryote Eukaryote Nucleus? No Yes Internal membranes? No (no organelles) Yes (membrane bound organelles) DNA Single chromosome; ring Many; linear Reproduction method Asexual (binary fission) Asexual and sexual Size Small 10 times as large as - [The Names of Living Things: Binomial nomenclature](https://schoolworkhelper.net/the-names-of-living-things-binomial-nomenclature/) - With the large diversity (variety) we need to sort or take inventory of everything (classify and name) classifying involves arranging living and nonliving things into groups which we can then study separately we also must give everything a name so that we can exchange information with others around the world. Naming Scientists have developed a - [Facilitated Diffusion & Active Transport](https://schoolworkhelper.net/facilitated-diffusion-active-transport/) - Facilitated Diffusion Allows diffusion of large, membrane insoluble compounds such as sugars (glucose) and amino acids Does not require energy (passive transport) Substance binds to membrane transport protein Molecules may enter the cell and leave the cell through the transport protein. Particles move from areas of high concentration to areas of low concentration; diffuse Active - [Genetic Disorders: Causes](https://schoolworkhelper.net/genetic-disorders-causes/) - Mutations - any change in a gene that is accompanied by a loss or change in the functioning of the genetic information; many mutations are harmful - spontaneous mutations have no known cause; improper crossing over, DNA replication - induced mutations are caused by mutagens; radiation, chemicals, viruses Somatic Mutations - occur in regular body - [Mendelian Genetics (Gregor Mendel)](https://schoolworkhelper.net/mendelian-genetics-gregor-mendel/) - Gregor Mendel is considered the "father" of genetics because he offered the first significant insights into the mechanisms involved in the inheritance of biological traits. His discoveries were made during the mid 19th century. Mendel was a Moravian monk who spent several years at the University of Vienna studying science to become a high school - [Human Karyotyping](https://schoolworkhelper.net/human-karyotyping/) - A karyotype is an organized profile of a person's chromosomes. Chromosomes are arranged and numbered according to: - size, from largest to smallest - banding pattern, size and location of Giesma bands - centromere location, appear as a constriction This arrangement helps scientists quickly identify chromosomal alterations that may result in a genetic disorder. Karyotype - [Meiosis: Purpose and Process](https://schoolworkhelper.net/meiosis-purpose-and-process/) - Sexually reproducing organisms create new offspring with the fusion of two parental cells. If two somatic cells, with a full complement of chromosomes, were allowed to unite, each new cell would have twice the number of chromosomes its parents had. To prevent this doubling from occurring in sexual reproduction, a special division process (meiosis) is - [The Respiratory System: Structure and Function](https://schoolworkhelper.net/the-respiratory-system-structure-and-function/) - Function supplies oxygen to cells and removes carbon dioxidedefending the body against invasion of microorganisms Respiratory Membrane wall of alveoli and wall of capillaries come together for form a respiratory membranegas exchange occurs across the respiratory membrane Gas Exchange exchange of gases (O2 & CO2) between the alveoli & the blood occurs by simple diffusiondiffusion - [The Physiology of Respiration](https://schoolworkhelper.net/the-physiology-of-respiration/) - Efficient gas exchange can only occur if the alveoli are regularly flushed with fresh air. Diaphragm: a muscle connected to the bottom of the lungs Pleura: a membrane that connects the lungs to the walls of the chest cavity INHALATION: Mechanism > external intercostals plus the diaphragm contract to bring about inspiration intercostals elevate ribs - [What is a Test Cross: Why is it used (Biology)](https://schoolworkhelper.net/what-is-a-test-cross-why-is-it-used-biology/) - If I handed you a black guinea pig & asked, "What's its phenotype for fur color?" You would gently hold the guinea pig, look at it and reply, "Black, you dummy ... all you gotta do is look at it". And I would say, "Correct, & please don't call me dummy". If I handed you - [Protein Synthesis](https://schoolworkhelper.net/protein-synthesis/) - DNA: DNA is the genetic information or blueprint of who and what we are, and how we operate. This genetic information is devoted to the synthesis of proteins, which are essential to our body. Proteins are created from templates of information called genes in our DNA. The Code: - DNA molecules are long polymers of - [Le Châtelier’s Principle](https://schoolworkhelper.net/le-chateliers-principle/) - If an equilibrium in a system is upset, the system will tend to react in a direction that will re-establish equilibrium 1) Adding or Removing a Reactant or Product - reaction shifts in a direction that will remove a substance added or replace a substance removed 2) Changes of Temperature - increasing temperature shifts a - [What is Half-Life? (Chemistry)](https://schoolworkhelper.net/what-is-half-life-chemistry/) - Period after which only half of the original number of nuclei in a sample of a radioactive element have not decayed. ex. half-life for uranium – 238 23892U = 4.6 x 109 years So after 4.6 x 109 years, only one half of the original uranium will be left - [What are acid/ base Indicators?](https://schoolworkhelper.net/what-are-acid-base-indicators/) - an indicator is an acid or a base that has a different colour from that of its conjugate general reaction for an acid indicator at equilibrium in an aqueous solution: - [Nuclear Chemistry/ Radiation](https://schoolworkhelper.net/nuclear-chemistry-radiation/) - radiation = substance emits radioactive particles or waves Types of Radiation: 1) Alpha (a) particle – high energy helium nucleus 42He 2) Beta (b) particle – high energy electron no > p+ + e- 3) Gamma (g) waves – electromagnetic photons Natural Transmutations Radioactive decay = change in nucleus that produces radiation Transmutation = change - [Heart Rate and Terms](https://schoolworkhelper.net/heart-rate-and-terms/) - Maximum Heart Rate: Your max heart rate is used as a tool to determine your target heart rate. It is also the maximum your heart should beat during exercise. That is why it is important to monitor your heart rate during exercise! Resting Heart Rate: This is your heart rate when you are at rest. - [Writing a Thematic Statement](https://schoolworkhelper.net/writing-a-thematic-statement/) - There is no one way to identify themes in texts. The following are two of the ways one might use to identify themes. One might try to see: Ways in which the main character has changed or what he or she has learned, and the nature of the central conflict. A Thematic Statement should be - [What is Diction, Syntax, Voice and Style?](https://schoolworkhelper.net/what-is-diction-syntax-voice-and-style/) - Diction Refers to the choice of words and phrases by a speaker or writer, and includes the formality of the language, as well as the emotional content, the imagery and specificity, and the sounds of the words. Effective diction is situational—there is no one correct way of using the language for all situations. An author - [How to write a Resume](https://schoolworkhelper.net/how-to-write-a-resume/) - Format: -Use bullet point form: paragraphs are hard to read and will often be overlooked by employers -Make use of the blank space: avoid leaving too much empty spaces around the content of the resume. -Functional Resume is often a good format to cover up inexperience and emphasize on skills. Sometimes your experience may be - [How to do a good interview](https://schoolworkhelper.net/how-to-do-a-good-interview/) - -PERSONALITY! This is very important! Chances are this will get you the job over someone with the same qualification. You want to demonstrate that you are a good fit to the organization and the job you are applying for. Always show that you are enthusiastic, positive, and professional. -Show initiative and leadership. In your answer, - [How to make a good Reference List](https://schoolworkhelper.net/how-to-make-a-good-reference-list/) - Provide the employer a list of references upon request. Do not include the reference list when you send your resume or fill in an application. Have your references on a separate piece of paper. Provide the prospective employer with the list of references when they ask for it. Be sure to request permission from your - [How to Apply for a Job](https://schoolworkhelper.net/how-to-apply-for-a-job/) - Part A: Include 2 completed job applications in your portfolio. Examples: Tim Hortons; City of Brampton; McDonald's; Walmart etc. Part B: Step 1 – FINDING EMPLOYMENT Find a classified job advertisement using any of the following websites or any other useful site: Step 2 – ANALYZING THE JOB ADVERTISEMENT 1)Copy and paste the ad into - [The Carbon Cycle](https://schoolworkhelper.net/the-carbon-cycle/) - All living things are on Earth are carbon based life forms, carbon is the essential element for all living things. On Earth, inorganic carbon (CO2) can be found: 1. in the atmosphere. 2. dissolved in oceans. Organic carbon is found in only one place: 1. as part of the bodies that are living things. Cycling - [The Nitrogen Cycle](https://schoolworkhelper.net/the-nitrogen-cycle/) - Nitrogen is required by living things to: 1. make proteins, become enzymes and make up the structures of living things 2. make nucleic acids that become DNA, the hereditary material of living things - 80% of the air around us is nitrogen gas (N2) but N2 cannot be used by most living things - N2 - [Cycling of Organic Matter](https://schoolworkhelper.net/cycling-of-organic-matter/) - The materials used in building the bodies of living things are limited to the atoms and molecules that make up this planet. To maintain life on Earth, matter must be recycled. Cycling of Organic Matter Living things are constantly cycling matter through their bodies and in ecosystems; break down organic matter and rebuild it. Organic - [What is Bioamplification?](https://schoolworkhelper.net/what-is-bioamplification/) - Bioamplification is the accumulation of toxic pollutants in an animal. Toxins can be removed from the bodies of animals through sweating and urination, but these toxins need to be water soluble. DDT, DDE, PCBs, toxaphene, and the organic forms of mercury and arsenic do biomagnify in nature. These substances are consequently known as 'persistent organic - [Collision Theory and the Rate of a Reaction](https://schoolworkhelper.net/collision-theory-and-the-rate-of-a-reaction/) - During a chemical reaction, reactant bonds need to be broken so that the atoms can rearrange to form the products. The kinetic energy of all the particles (the molecules, compounds, elements, atoms and ions) reacting is responsible for the breaking of these bonds. Remember, the temperature of the particles is a measure of the average - [Enthalpy Change](https://schoolworkhelper.net/enthalpy-change/) - Enthalpy change is also known as heat of reaction, enthalpy of reaction, change in heat content. Enthalpy = total energy of a system It is impossible to measure the total kinetic and potential energy of a system, so instead we measure enthalpy change (using calorimeters). Enthalpy Change - is the energy absorbed from or released - [Rate Laws and Order of Reaction](https://schoolworkhelper.net/rate-laws-and-order-of-reaction/) - Chemical reactions only take place when there are collisions between reactants Depends on: Number of collisions per unit time Fraction of collisions which are successful There is a relationship/pattern between reaction rate and the factors that affect it This pattern can only be determined empirically (through experimentation) Rate Law Empirical evidence supports that the reaction - [Shapes of Molecules](https://schoolworkhelper.net/shapes-of-molecules/) - The shape of a molecule determines many of its properties; For example: C4H10 is the formula for 2 separate molecules n-butane and isobutene Melting Point -138°C -159°C Boiling Point -0.5°C -12°C Enzymes---shape compatible with those molecules whose reactions they promote i.e. the enzyme sucrase breaks down the sugar molecule sucrose The shape of a - [Standard Enthalpies of Formation](https://schoolworkhelper.net/standard-enthalpies-of-formation/) - The quantity of energy associated with the formation of one mole of a substance from its elements (in their standard states). The standard states (at SATP) of most elements is solid, except for the gaseous diatomic molecules, H2, O2, N2, F2, Cl2, and the two liquid elements Hg and Br2. These energies can be looked - [Alternative Metabolic Pathways](https://schoolworkhelper.net/alternative-metabolic-pathways/) - Carbohydrates are the first nutrient most organisms catabolise for energy, however, living things must metabolize other energy-rich nutrients to obtain energy in times of starvation Protein Catabolism - first digested into amino acids - amino groups are removed (deamination; amino group à ammonia [NH3]) - remaining portion of amino acid converted into various components of - [Homeostasis and the Endocrine System: Blood Sugar Levels](https://schoolworkhelper.net/homeostasis-and-the-endocrine-system-blood-sugar-levels/) - Pancreas: > produces digestive enzymes and hormones > hormone producing cells are in the islets of Langerhans > islets contain beta (produce insulin hormone) and alpha cells (produce glucagon hormone) Insulin: > produced in beta cells > released when blood sugar level increases > cause muscle cells, the liver and other organs, to become permeable - [C4 and CAM Plants](https://schoolworkhelper.net/c4-and-cam-plants/) - - O2 competes with CO2 for rubisco’s active site - rubisco catalyzes two reactions: 1) addition of carbon to RuBP; forms 2 PGA molecules (photosynthesis) 2) addition of oxygen to RuBP; forms 1 PGA and one glycolate (photorespiration) - photorespiration decreases the production of carbohydrates by removing PGA from the Calvin cycle - glycolate is - [Electron Transport and Chemiosmosis](https://schoolworkhelper.net/electron-transport-and-chemiosmosis/) - NADH and FADH2 carry electrons to the ETC Each become oxidized, losing two electrons to the ETC The Electron Transport Chain (ETC) Structure Located within the inner mitochondrial membrane Composed of various protein structures arranged in order of increasing electronegativity Ex. weakest electron attractor (NADH dehydrogenase) is at the beginning of the chain and the - [Energy Flow in Living Systems](https://schoolworkhelper.net/energy-flow-in-living-systems/) - Living organisms must continually capture/acquire, store, and use energy to carry out the functions of life. Capturing/acquiring, storing and using energy are accomplished through cellular chemical processes. Cells are chemical machines that obey fundamental chemical and physical laws of nature. The sum of a cells chemical reactions is called metabolism. Energy Energy is the ability - [Homeostasis Components and Feedback](https://schoolworkhelper.net/homeostasis-components-and-feedback/) - The human body works best at 37°C, with a 0.1% blood sugar level and a blood pH level of 7.35 The external environment and making demands on your body do not always provide the ideal conditions for life Your body must adjust these variations to maintain a stable internal environment Homeostasis is a term used - [Thermoregulation](https://schoolworkhelper.net/thermoregulation/) - Thermoregulation is the maintenance of body temperature within a range that enables cells to function efficiently. Mammals, including humans, are endotherms, able to maintain a constant body temperature regardless of our surroundings. The hypothalamus acts as your body's “thermostat”, detecting changes in body temperature and sending out messages to help restore the normal body temperature. - [DNA Mutations](https://schoolworkhelper.net/dna-mutations/) - Mutations are errors made in the DNA sequence than can have negative side effects, no effect, or positive effects for an organism Point Mutations Mutations that occur at a certain point in the DNA Substitution – the replacement of one base in a DNA sequence by another base Deletion – the elimination of a base - [The Nervous System Anatomy and Function](https://schoolworkhelper.net/the-nervous-system-anatomy-and-function/) - The nervous system is an elaborate communication system that functions to regulate the actions of your body to maintain the internal environment within safe limits Nerve Cells: Glial cells - non-neuronal cells that provide support and nutrition, maintain homeostasis, form myelin, and participate in signal transmission in the nervous system. Functions: - surround neurons and - [Light Energy and Photosynthetic Pigments](https://schoolworkhelper.net/light-energy-and-photosynthetic-pigments/) - Light Reactions: - require chlorophyll and take place in thykaloid membranes - absorb light energy and transfer it to ADP and NADP+ - energy is transferred to carbohydrate molecules in the Calvin cycle Carbon Fixation: - incorporate molecules of CO2(g) into organic molecules, such as glucose - require energy from ATP and NADPH - takes - [The Calvin Cycle](https://schoolworkhelper.net/the-calvin-cycle/) - - cyclic process in the stroma that converts carbon dioxide into carbohydrate molecules - three phases: 1) carbon fixation, 2) reduction reaction, 3) RuBP regeneration Phase 1: Carbon Fixation - C02 added to RuBP -> unstable 6-carbon intermediate -> 2 3-carbon PGAs - required to occur three times, 3 CO2 + 3 RuBP -> 6 - [Restriction Endonucleases (or Restriction Enzymes)](https://schoolworkhelper.net/restriction-endonucleases-or-restriction-enzymes/) - - obtained from bacterial cells where they act as an immune system, they digest foreign DNA molecules from viruses - molecular scissors that cut DNA at a specific base-pair sequence (the recognition site) - they scan DNA, stop at their recognition sites, then disrupt the phosphodiester bonds and the hydrogen bonds between nucleotides cutting a - [Synaptic Transmission](https://schoolworkhelper.net/synaptic-transmission/) - > synapse: spaces between neurons, or between neurons and effectors > vesicles containing chemical neurotransmitters are located at the end of neuron axons Electrical Signals: > electrical impulses moving along the axon stimulate the release of neurotransmitters Chemical Signals: > neurotransmitters are released from the presynaptic neuron and diffuse across the synaptic cleft > neurotransmitters - [How to Write Hypothesis for Lab Report](https://schoolworkhelper.net/how-to-write-hypothesis-for-lab-report/) - What Is a Real Hypothesis? A hypothesis is a tentative statement that proposes a possible explanation for some phenomenon or event. A useful hypothesis is a testable statement that may include a prediction. When Are Hypotheses Used? The keyword is testable. That is, you will perform a test of how two variables might be related. - [Protein Synthesis: Transcription](https://schoolworkhelper.net/protein-synthesis-transcription/) - Initiation: - Upstream of the gene, RNA polymerase binds to a genes promoter region and unwinds the DNA double helix Elongation: - RNA polymerase starts building an mRNA, using the template strand of the DNA molecule, in the direction of 5’ to3’ - the strand that is not copied is called the coding strand - - [Ethical/ Social Issues in Biology](https://schoolworkhelper.net/ethical-social-issues-in-biology/) - Organ Transplantation - Living donations of the kidney, part of liver, lobe of lung, part of intestine and portion of pancreas can be made - A donor must be healthy in order to give an organ - The demand for living organs is increasing - For cultural and personal reasons, some are resistant to transplants - [External Influences Affecting the Marketing Mix](https://schoolworkhelper.net/external-influences-affecting-the-marketing-mix/) - Economic Influence Economic TrendsDomestic and International Trade Competitive Influence Market StructureCompetitive StrategyCompetitive Position Social and Demographic Influences Demographic TrendsMulticulturalismLifestylesEcological Concerns Technological Influence AdvancesResearch and Development InvestmentInformation Technology Legal and Regulatory Influence Federal Laws/RegulationsProvincial Laws/RegulationsSelf-regulation - [Biography of Ken Kesey](https://schoolworkhelper.net/biography-of-ken-kesey/) - He is the author of the novel, One Flew Over the Cuckoo's Nest (1962). An Academy award-winning film version of the novel was directed by Milos Forman in 1975, starring Jack Nicholson as the main character, McMurphy. Dale Wasserman wrote an adaptation of the novel which played on Broadway. Kirk Douglas had bought the right - [Bacteria Types and Classification](https://schoolworkhelper.net/bacteria-types-and-classification/) - All Bacteria have the following characteristics: Unicellular and stick together in colonies Are prokaryotic (no nucleus, vacuoles, mitochondria or chloroplasts) They have a single chromosome in a DNA loop They reproduce asexually by binary fission Live in moist environment and are inactive in dry environments Two groups of Bacteria 1. Archaebacteria – primitive bacteria that - [Types of Microscopes and Calculations](https://schoolworkhelper.net/types-of-microscopes-and-calculations/) - Transmission Electron Microscope (TEM) -very expensive with 2 million times magnification - specimen must be cut very thinly and must be dead Scanning Electron Microscope (SEM) - produces a 3-D image of the surface - whole specimen must be dead Compound Microscope – the one we use - two lenses illuminated by a light source - [Viral Replication (Lytic Cycle)](https://schoolworkhelper.net/viral-replication-lytic-cycle/) - Four basic Steps: 1. Attachment and entrance: the virus recognizes the host cell and attaches. The whole virus or just it's genetic material enters the cell. 2. Synthesis of proteins: The genetic material of the virus (DNA or RNA) instructs the cell to start making viral proteins and nucleic acids (DNA/RNA) 3. Assembly of a - [Scientific Taxonomy](https://schoolworkhelper.net/scientific-taxonomy/) - - the study of categorizing organisms Binomial Nomenclature – two-part scientific naming of organisms - the first word identifies the genus and the second word is the species Example: Ursus americanus – Ursus horribilis – Ursus arctos – Ursus maritimus – NOTE: the format: capitals and italics Levels of Classification (7) or Taxa: “King - [Fungi Structure and Function](https://schoolworkhelper.net/fungi-structure-and-function/) - Common fungi: mushrooms, moulds, yeast and truffles 1. Cell Type: eukaryotic 2. Type of Reproduction: asexual and sexual life cycle Sex cell = spores - made by the sporangium - spores are spread by wind - spores germinate (grow) Asexual fragmentation may also occur 3. Characteristics nonmotile mycelium – vegetative part, under ground wide variety - [German and Prussia History](https://schoolworkhelper.net/german-and-prussia-history/) - From 1815 to 1847 - The restored rulers of the German states would reverse/weaken any reforms from the Napoleonic period - Student fraternities (Burschenschaft) the most radical element in Germany Conservative Historian assassinated, Metternich convinces Emperor of Austria/King of Prussia to institute the Carlsbad Decrees (dissolve fraternities & censorship) - Further revolts towards 1830 German - [Diplomats, Diplomatic Immunity, Diplomatic Asylum](https://schoolworkhelper.net/diplomats-diplomatic-immunity-diplomatic-asylum/) - The notion of diplomatic immunity dates back to ancient times and was enshrined in international law in the 1961 Vienna Convention on Diplomatic Relations. Simply put, diplomats have blanket immunity from local laws in the countries where they are posted. That means that while diplomats can be charged with criminal offences, or sued in civil - [US Diplomatic Hostages In Iran Case Analysis](https://schoolworkhelper.net/us-diplomatic-hostages-in-iran-case-analysis/) - On November 4, 1979, several hundred Iranian students and other demonstrators took possession of the US embassy in Tehran by force, in protest at the admission of the deposed Shah of Iran into the United States for medical treatment. The demonstrators were not opposed by the Iranian security forces. US consulates elsewhere in Iran were - [International Court of Justice World Court](https://schoolworkhelper.net/international-court-of-justice-world-court/) - The ICJ is the principal judicial organ of the UN. The seat of the Court is the Peace Palace of The Hague (Netherlands) while the other five organs of the UN are all located in NY. 1st case May 1947. From May 1947 to January 2010 - 146 cases were entered into. Sample disputes they - [Human Rights Infractions Against Women](https://schoolworkhelper.net/human-rights-infractions-against-women/) - 1. TRAFFICKING The buying and selling of women for the purpose of prostitution, domestic labour, to settle debts and for forced marriages, usually by families who cannot afford to support them. 2. HONOUR KILLING Male relatives kill female relatives for a number of reasons: adultery (sex outside of marriage), for seeking divorce, for seeking marriage - [Improving Your Power Point Presentations](https://schoolworkhelper.net/improving-your-power-point-presentations/) - 1. Use the same background for all the slides. When in doubt, use one of the Design Templates that came with PowerPoint. These templates guarantee a professional looking background every time. 2. Pick High Contrast colours. High contrast means light letters on a dark background. High contrasting colours make it much easier to read the - [Forensic Department Divisions and Roles](https://schoolworkhelper.net/forensic-department-divisions-and-roles/) - These are the main areas of concern in the morgue and that make up forensics. They can exist as a separate department or could be combined. It depends on the size of the city and the number of crimes that occur there. Anthropology Anything related to skull or skeletal parts, identification of people, reconstructive techniques - [Overview of Evidence Used in Criminal Trials](https://schoolworkhelper.net/overview-of-evidence-used-in-criminal-trials/) - Evidence—Any proof legally presented through witnesses, records, documents, exhibits or other concrete objects for the purpose of introducing belief in the minds of the court, judge or jury. The rules of evidence are found in The Canada Evidence Act. Purpose—Evidence is information that proves or disproves disputed facts. Evidence must be legally obtained, admissible and - [Canadian Nationalism](https://schoolworkhelper.net/canadian-nationalism/) - At the root of the split in Canada is the reality that two European empires had colonized and dominated history after contact. Of course we talking about the tensions between Canadians of British and French backgrounds. During the phase of the Canada’s early development after confederation frustrations on both sides often boiled over as result - [Hamlet: Analysis of Scene Act I, Scene III](https://schoolworkhelper.net/hamlet-analysis-of-scene-act-i-scene-iii/) - Act I Scene III contrasts Polonius’s different attitude towards Laertes and Ophelia, which he regards Laertes more important than Ophelia. When he speaks to Laertes, he says: “And you are stay’d for. There; my blessing with thee!” (Act I, Scene III, Line 57) While when he criticizes Ophelia’s affection with Hamlet, he says: “Affection? pooh! - [Hamlet: Analysis of Scene Act I, Scene II](https://schoolworkhelper.net/hamlet-analysis-of-scene-act-i-scene-ii/) - This scene advances the plot when Horatio, Bernardo and Marcellus reveal to Hamlet that his father's ghost has appeared. "A figure like your father, Armed to point, exactly, cap-a-pe" (1.2.199-200). It advances the plot as it drives Hamlet to confront the ghost and gives the ghost the opportunity to reveal the true nature of his - [Hamlet: Analysis of Scene Act I, Scene V](https://schoolworkhelper.net/hamlet-analysis-of-scene-act-i-scene-v/) - Advances the Plot “Revenge his foul and most unnatural murder” (act i, v, 25) Learns of his father’s death Murdered by his uncle Learning this Hamlet wishes to avenge his father Links Incidents in the Plot “With witchcraft of his wit, with traitorous gifts,- wicket wit and gifts, that have the power So to seduce!- - [Hamlet: Analysis of Scene Act I, Scene IV](https://schoolworkhelper.net/hamlet-analysis-of-scene-act-i-scene-iv/) - Develops Suspense and Atmosphere Throughout the play it has a serious tone and because of this scene taking place at night, it develops a mysterious atmosphere to it. Furthermore, there are supernatural elements in this scene. Therefore, it creates a more tense mood. This scene creates suspense because the scene ends with Hamlet follows the - [Understanding Theme](https://schoolworkhelper.net/understanding-theme/) - A Theme is a statement of the central idea or message in fiction, narrative or poetry. It is usually not stated explicitly, but rather developed through the characters, plot, narrator’s point of view, and language. It differs from a Topic which is the subject matter being written about, and a Thesis which is an contentious - [What is Satire?](https://schoolworkhelper.net/what-is-satire/) - Definition: Satire is the literary art of diminishing a subject by making it ridiculous and evoking towards it attitudes of amusement, contempt or scorn. Characteristics: Satire uses laughter as a weapon to convince the listener or reader of the author’s position. Satire “derides” a problem or situation. Satire may be individual, this is called “Personal - [What is Symbolism?](https://schoolworkhelper.net/what-is-symbolism/) - A symbol in most general terms is a technique used in literature (and other forms of art – like film) to signify something else of abstract merit or meaning that the author, artist, or filmmaker realizes that the audience will instantly recognize and understand. Symbolism adds depth to the understanding of the message and creates - [Arthurian Legend: Notes and Research](https://schoolworkhelper.net/arthurian-legend-notes-and-research/) - a) Arthur – early life – marriage – death Arthur was son of Uther, King of England and only son born to Igraine of Cornwall. Merlin used his magic to make Uther resemble Gorlois, Igraine’s real husband. After Arthur is born, he is sent away to be raised by Merlin, who gave him to Ector - [Analyzing Fiction](https://schoolworkhelper.net/analyzing-fiction/) - Analysis: the main purpose of analysis is to illuminate something, such as a concept, a text, an event, or a set of data, by examining its parts in detail. Considerations for analyzing setting: * The place, time, and social environment with which the action takes place What are the most important locations in the work? - [Rhetorical and Poetic Devices](https://schoolworkhelper.net/rhetorical-and-poetic-devices/) - Anacoluthon – In rhetoric, a break or change in direction in a speech, often signaled by a dash. Example: “I was listening to the news – this man he’s a company director in London – the police arrested him.” Anadiplosis – A word repeated for effect. Example: “Victory at all costs, victory in spite of - [Various Types of Literary Analysis](https://schoolworkhelper.net/various-types-of-literary-analysis/) - Literary analysis is a critical response to a literary text in the form of a critical essay or an oral commentary. It includes a thorough interpretation of the work. Such analysis may be based on a variety of critical approaches or movements, e.g. archetypal criticism, cultural criticism, feminist criticism, psychoanalytic criticism, Marxist Criticism, New Criticism - [The Wars: Essay Topics](https://schoolworkhelper.net/the-wars-essay-topics/) - You are to select one of the following topics and write an academic, formal, literary essay with an introduction, body paragraphs, transition paragraphs and a conclusion. It should be no more than five typed pages (double spaced-including quotations) 1. “Robert Ross comes riding straight towards the camera. His hat has fallen off. His hands are - [Lord of The Flies: Chapter 1 Characters, Themes, and Analysis](https://schoolworkhelper.net/lord-of-the-flies-chapter-1-characters-and-themes-analysis/) - THEMES 1. Archetypal journey from innocence to experience - the innocent stage: a group of young boys (children represent innocence and purity); the island at first seems like a beautiful paradise/Garden of Eden. - the experienced stage: what they go through ("the fall from grace") and the devastating, irrevocable changes that result. 2. Civilisation vs. - [Four Basic Comma Rules](https://schoolworkhelper.net/four-basic-comma-rules/) - 1. Use commas to separate items in a series of three or more. e.g. The required subjects in this program are math, physics, and English. Tom went to the movies, Jan and Jasmine went to play pool, and I went to bed. Exercise: Insert commas where necessary in the following sentences. 1. The five largest - [10 (Pre 19th Century) Characteristics of Tragedy](https://schoolworkhelper.net/10-pre19th-century-characteristics-of-tragedy/) - Tragedies present tales of suffering and calamity, often involving violence and death; though in Greek tragedy, the violence and death always occur offstage, in Shakespearean tragedy, the deaths sometimes take place on stage. Tragedies lead to the deaths of "exceptional" people such as royalty, nobility, etc. The idea is that the higher a person is - [Literary Essay: Peer Editing Guidelines](https://schoolworkhelper.net/literary-essay-peer-editing-guidelines/) - STEP ONE: COMMUNICATION Circle ALL spelling and grammar errors. If there are any errors in terms of the correct format of quotations and citations, indicate the error and what the problem is. Check the structure of the body paragraphs: ensure they are in the SQA format. STEP TWO: THINKING Carefully read all of the ANALYSIS - [When to use a capital letter and a Period](https://schoolworkhelper.net/when-to-use-a-capital-letter-and-a-period/) - CAPITAL LETTER The beginning of a sentence Proper names of people and places Canada, Rome, Toronto, Sandalwood Heights, Teddy, Toronto General Hospital Titles Queen Elizabeth, Captain Torres, Miss Butler The first letter of each word in a title Just Lather, That’s All The Fall of a City For the word “I” The date, days of - [The Bombings of Hiroshima and Nagasaki](https://schoolworkhelper.net/the-bombings-of-hiroshima-and-nagasaki/) - August 6 and 9, 1945 At 2:45 in the morning of August 6, 1945, an American B-29 bomber flew north from Tinian Island in the Marianas toward Japan. Three and a half hours later, over the city of Hiroshima, the Enola Gay dropped an 8,900-pound atomic weapon from its specially modified bomb bay. Two thousand - [Bootlegging, Prohibition, Al Capone (1920)](https://schoolworkhelper.net/bootlegging-prohibition-al-capone-1920/) - During the time period of 1920 to 1933, the governments of the United States of America and Canada made the manufacture, distribution, and sale of alcoholic beverages illegal. This was meant to decrease crime rates in both countries. Instead, of their dream of a crime-free society, both governments got more than they could handle. This - [Canada and The Dirty Thirties](https://schoolworkhelper.net/canada-and-the-dirty-thirties/) - Richard Bedford (R.B.) Bennett replaces King as P.M. in 1930 Bennet promises work for all, $20 million for emergency funds and to deal with foreign trade policies His policies did little to help the economic conditions in Canada Bennett set up relief camps for single unemployed men Men worked cutting brush and building roads for - [Causes of the Great Depression](https://schoolworkhelper.net/causes-of-the-great-depression/) - There are various explanations for the causes of the great depression that started in 1929. Some of the most likely causes are given below: 1. OVER-PRODUCTION AND OVER-EXPANSION During the decade of the Roaring Twenties, many industries expanded their production beyond demands.Much money was spent adding factories and building new onesThere was an over-production of - [Life During The Great Depression](https://schoolworkhelper.net/life-during-the-great-depression/) - UNEMPLOYMENT In 1930 Canada had 13% unemployment; by 1933 it was 26% (fell back to 13% when WWII broke out)Between 1929 and 1933, 1 in 5 Canadians depended on government relief for survivalIn Saskatchewan, income dropped by 90% forcing 66% of the rural population onto welfare no severance pay or unemployment insurance to fall back - [Slang of the 1920s](https://schoolworkhelper.net/slang-of-the-1920s/) - All Wet - Describes an erroneous idea or individual, as in, "he's all wet." Applesauce - an expletive; same as horsefeathers; as in "Ah applesauce!" Bee's Knees - An extraordinary person, thing, idea; the ultimate Berries - That which is attractive or pleasing; similar to bee's knees; as in "It's the berries." Big Cheese - - [Battles of World War I: Ypres, Somme, Vimy Ridge, Passchendale](https://schoolworkhelper.net/battles-of-world-war-i-ypres-somme-vimy-ridge-passchendale/) - GAS ATTACKS AT YPRES “I have never been in a battle — and I have been in many — where the men were suffering in such numbers that their crying and groaning could be heard all over the battlefield.” Anonymous Soldier Canada’s first major battle in the war, near ancient city of Ypres in Belgium - [Trench Warfare Terms](https://schoolworkhelper.net/trench-warfare-terms/) - Digging In- Troops on both sides dug deep trenches/ditches in the ground for protection. Trenches were about 2 meters deep by 1.5 m wide No-man’s-land- A neutral territory between the allies and the enemy; it was suicidal to be caught in no-man’s-land “Over the Top”- An advance frontal attack over the trenches and across no-man’s-land - [Who Declared War on Who in WWI](https://schoolworkhelper.net/who-declared-war-on-who-in-wwi/) - The 'Great War', which began on 28 July 1914 with Austria-Hungary's declaration of war with Serbia, was the first truly global war. It began in Europe but quickly spread throughout the world. Many countries became embroiled within the war's first month; others joined in the ensuing four years, with Honduras announcing hostilities with Germany as - [Why Do People Go To War?](https://schoolworkhelper.net/why-do-people-go-to-war/) - Soldiers in World War One fought under terrible conditions and were often slaughtered in useless attacks - yet millions volunteered to go. Why? 1) Patriotism and Nationalism A strong sense of national pride made men feel that it was their duty to fight. 2) Honor and Glory Many men saw the war as a - [Germany After WWI](https://schoolworkhelper.net/germany-after-wwi/) - ECONOMIC PROBLEMS (INFLATION) Instead of taxing its people to finance WWI, Germany had borrowed the money. Thus it had burdened its citizens with a huge debt. To payoff this debt after the war, the German government simply printed more money. This was done even though the country’s industry, agriculture, and commerce were not expanding because - [The Dieppe Raid](https://schoolworkhelper.net/the-dieppe-raid/) - Winston Churchill and Allies under intense pressure to "do something" to relieve pressure on Soviet Union - "Operation Jubilee" was to be a quick raid: - Gather information, test tactics for a later invasion, worry the Nazis - Aug. 19th, 1942 6000 troops land in France (5000 are Canadians): - 900 die on beaches - - [Start of World War II](https://schoolworkhelper.net/start-of-world-war-ii/) - BLITZKRIEG The German word meaning "lightening war", the military strategy of softening a country up through intensive air raids followed by rapid use of armoured and infantry units, based on speed and surprise. revolutionary style of hard, fast warfare based on surprise attack the key to its success was close co-operation between the German Panzer - [Hitler’s Views of the Jewish People](https://schoolworkhelper.net/hitlers-views-of-the-jews/) - 1. The Jews wanted to denationalize and de-stabilize Germany by: Sowing confusion Lowering the racial level of the highest Dominate the races by exterminating the intelligentsia (intelligent people) Replace them (the intelligentsia) with members of the Jewish race Race mixing, e.g. the Jews brought Blacks in the Rhineland – this led to the cohabitation of - [Steps to and Strategies for Writing News Reports](https://schoolworkhelper.net/steps-to-and-strategies-for-writing-news-reports/) - When writing a News Report on the Literacy Test, you should follow these steps: Analyse the picture and Headline provided (if they are provided) to determine your article’s content. Jot down the 5WH (who, what, where, when, why, and how) of your article in the rough notes section provided on the test paper. Create an - [Ancient Japan](https://schoolworkhelper.net/ancient-japan/) - An Introduction Our Records... Japan does not appear in history until 57 CE when it is first mentioned in Chinese histories. In these histories, it is referred to as "Wa." The Chinese historians tell us of a land divided into a hundred or so separate tribal communities without writing or political unity. Their Records... The - [Heian Period](https://schoolworkhelper.net/heian-period/) - Movement to “Heian-kyo” known today as Kyoto, capital of Japan from 794 until 1868 Abandoning the Chinese Sent no further missions to China severed continental contact = increasing independence, adaptation The City of Heian-kyo Rectangular about 2 1/2 miles across from west to east and about 3 1/2 miles long from north to south. A stone - [Types of Assault](https://schoolworkhelper.net/types-of-assault/) - There are three levels of assault: 1) Simple Assault occurs when an individual Applies intentional force to another person without the other person’s consentAttempting or threatening, by an act or gesture to apply forceApproaching or blocking the way of another person while openly wearing or carrying a weapon or an imitation of a weapon. 2) - [Grounds of Discrimination](https://schoolworkhelper.net/grounds-of-discrimination/) - Activities protected by human rights legislation include employment, accommodation and facilities, and meeting special needs. 1. Employment Everyone has a right to “equal treatment with respect to employment” in the job application process, as well as in training, transfers, promotions, apprenticeship, dismissal, and layoffs. CONSTRUCTIVE AND DIRECT DISCRIMINATION Constructive Discrimination – employment policies that inadvertently - [Crime Definitions](https://schoolworkhelper.net/crime-definitions/) - Homicide: killing another human being, either directly or indirectly Non-Culpable Homicide: is not criminal and occurs when death is caused by complete accident or in self-defence First Degree Murder: - is planned and deliberate (considered, not impulsive) - victim is a law enforcement agent - occurs while another offensive crime is being committed - occurs - [Romantic Elements](https://schoolworkhelper.net/romantic-elements/) - 1. Infinitely striving for the unattainable. Trying to achieve something that will never be real. Enjoying the act of always wanting what you can’t have. 2. Powerful love. Heart stirring, often sudden, emotions create a life or death commitment. 3. Uncertainty of reciprocation of love. What is the beloved thinking? Is the lover's love returned - [Gothic Elements](https://schoolworkhelper.net/gothic-elements/) - 1. Setting in a castle. The action takes place in and around an old castle, sometimes seemingly abandoned, sometimes occupied. The castle often contains secret passages, trap doors, secret rooms, dark or hidden staircases, and possibly ruined sections. 2. An atmosphere of mystery and suspense. The work is pervaded by a threatening feeling, a fear - [Canadian Charter of Rights and Freedoms Sections](https://schoolworkhelper.net/canadian-charter-of-rights-and-freedoms-sections/) - Fundamental Freedoms Reflect civil liberties that imply we are free to do what is not prohibited by law These include: (a) freedom of conscience and religion; (b) freedom of thought, belief, opinion and expression, including freedom of the press and other media of communication; (c) freedom of peaceful assembly; and (d) freedom of association. Food - [Hamlet: Structure, Themes, Imagery, Symbols](https://schoolworkhelper.net/hamlet-structure-themes-imagery-symbols/) - HAMLET’S STRUCTURE: Like most of Shakespeare's plays, the act divisions of later editions of Hamlet have little relation to the play's structure, and there is no break between some scenes. In terms of production, Hamlet has three major movements: Movement One (I.i-I.v). This section sets the action in motion in three main rhythms: 1. the - [Guide to Writing a Successful Press Release](https://schoolworkhelper.net/guide-to-writing-a-successful-press-release/) - The Headline Summarise the key information in ten words or less Grab readers’ attention Make main idea clear Compel readers to read on Example -- Night says Goodnight: Oxford Professor Fired Over Plagiarism Scandal Opening Paragraph (Summary Lead) Explain the five Ws and one H of the event: all essential info is here Include the - [What is Existentialism?](https://schoolworkhelper.net/what-is-existentialism/) - Existentialists believe that man's own individual experience or "existing" comes before anything such as a general purpose, goodness or “truth,” or any other Absolute that may be felt to exist. Man creates himself through his own thoughts and actions since the only reality for an individual is that of his own personal existence and nothing - [Beloved: Title Significance](https://schoolworkhelper.net/beloved-title-significance/) - The character of Beloved is a paradigm for an angry, painful sense of memory and suffering. She starts out as a vengeful, willful ghost who haunts Sethe, the woman who gave birth to and also killed her in the past. As soon as Sethe encounters Beloved, while she doesn’t seem to understand or react emotionally - [Modernism Art, Literature, Music](https://schoolworkhelper.net/modernism-art-literature-music/) - The term “modernism” designates a movement in art, literature and music, beginning in the 19thC and lasting into the 20thC, ending approximately with WW II. Art which is modernist may possess the following 12 characteristics: it is psychological in nature and attempts to render individual consciousness or a more subjective reality its depiction of time - [Life of Pi: Quotation Bank](https://schoolworkhelper.net/life-of-pi-quotation-bank/) - VIII Then, the elderly man said, “I have a story that will make you believe in God.” 6 The reason death sticks so closely to life isn't biological necessity – it’s envy. Life is so beautiful that death has fallen in love with it, a jealous, possessive love that grabs at what it can. But - [Unique Properties of Water](https://schoolworkhelper.net/unique-properties-of-water/) - Water is a unique substance essential to life. It is the most abundant molecule in any cell. The human body is 55-78% composed of water. 1. Polar Molecule – A polar covalent bond is formed between oxygen and hydrogen. The oxygen atom is slightly negative and the hydrogen is slightly positive due to unequal sharing - [Isomers: Structure and Function](https://schoolworkhelper.net/isomers-structure-and-function/) - In chemistry, isomers are compounds with the same molecular formula but different structural formulas. The word is derived from the Greek ισομερης, isomerès; isos = "equal", méros = "part". There are many different classes of isomers, like stereoisomers, enantiomers, geometrical isomers (see chart below). Isomers do not necessarily share similar properties, unless they also have - [Dna: Structure and Function](https://schoolworkhelper.net/dna-structure-and-function/) - DNA or nucleic acid is a polymer of nucleotides. A nucleotide consists of 3 molecules: a 5-carbon sugar (pentose) either deoxyribose (in DNA) or ribose (in RNA) a phosphate attached at the #5 carbon of the sugar an organic or nitrogenous base – a nitrogen containing ring structure – attached at the #1 carbon of - [Magnetism & Electromagnetism](https://schoolworkhelper.net/magnetism-electromagnetism/) - Electric Current (the movement of electrons) in a wire can produce a force at a distance (a field) on metals made of any combination of Iron, Nickel, and Cobalt. This is an electromagnet. All neutral atoms have electrons moving in orbits. Some atoms (Iron, Nickel, and Cobalt) have an electron arrangement that act like tiny - [What is Deterrence theory?](https://schoolworkhelper.net/what-is-deterrence-theory/) - Deterrence theory contains principles about justice which many of us find attractive because it conforms to what we recognize as fairness. The wicked should be punished –quickly –to the extent that pain will deter them from committing a crime again. Deterrence theory so permeates our thinking that we recognize it as the model by which - [HOW TO WRITE A SUMMARY](https://schoolworkhelper.net/how-to-write-a-summary/) - A summary is a concise version of an original text. What is a good summary? 1. A good summary should give an objective outline of the whole piece of writing. It should answer basic questions about the original text such as "Who did what, where, and when?", or "What is the main idea of the - [The Hardy Weinberg Principle](https://schoolworkhelper.net/the-hardy-weinberg-principle/) - Genetics Definitions Genes: portion of the DNA molecule that codes for a particular protein. Loci: location in the DNA molecule of the gene Alleles: forms of a gene Homozygous: paired alleles are identical Heterozygous: paired alleles are different Genotype: set of all alleles (i.e. genetic expression) Phenotype: all observable traits (i.e. physical expression) Genome: The - [What is Evolution?](https://schoolworkhelper.net/what-is-evolution/) - Evolution describes the changes in the gene pool of a species over time. These changes are the results of mutations, natural selection and genetic drift. Often populations produce more offspring than the environment can support; in other words, they often exceed the carrying capacity. Over-production of offspring leads to intraspecific competition and survival of the - [Respiratory Disorders: Asthma, Bronchitis, Emphysema, Cystic Fibrosis](https://schoolworkhelper.net/respiratory-disorders-asthma-bronchitis-emphysema-cystic-fibrosis/) - Asthma - results in contraction of smooth muscle that surrounds airways - makes breathing difficult - allergic reaction - treat with bronchodilators - causes airways to dilate (increase in diameter) Bronchitis - inflammation of bronchial lining + overproduction of mucous and frequent coughing - related to smoking and other irritants (air pollution etc) - increased - [Oxygen/ Carbon Transport](https://schoolworkhelper.net/oxygen-carbon-transport/) - - inhale - oxygen travels down the bronchi and bronchioles - into the alveoli - oxygen strikes the moist coating of the alveolar wall - dissolves in this liquid - moves by diffusion through the cells of the alveoli, and into the cells of the capillaries - enters the red blood cells which will transport - [The Polymerase Chain Reaction (PCR): Cloning DNA in the Test Tube](https://schoolworkhelper.net/the-polymerase-chain-reaction-pcr-cloning-dna-in-the-test-tube/) - The polymerase chain reaction is a technique for quickly "cloning" a particular piece of DNA in the test tube (rather than in living cells like E. coli). Thanks to this procedure, one can make virtually unlimited copies of a single DNA molecule even though it is initially present in a mixture containing many different DNA - [Incomplete Dominance or Codominance](https://schoolworkhelper.net/incomplete-dominance-or-codominance/) - Incomplete Dominance - there is an interaction between 2 alleles in the homozygous form - alleles are semi - or incompletely dominant and act together to yield an intermediate heterozygote - usually phenotypically between the two homozygote Codominance - when definite product or substance controlled by each allele is identified ex. of incomplete dominance: Andalusian - [Mapping Skills - What you need to know!](https://schoolworkhelper.net/mapping-skills-what-you-need-to-know/) - There a 6 essential features needed to create maps. - MUST HAVES Title: A title should tell the reader both what the map is about and where the map is depicting. It should be located at the top of a map, in large print, inside the border of the map. eg. Land Use in Mississauga, - [Tips & Advice for High School Students](https://schoolworkhelper.net/tips-advice-for-high-school-students/) - Feel like everyone's always yelling at you for not doing what you're supposed to be doing? Look, this is your life, and you need to get in charge of it if you don't want everyone making decisions for you. I teach parents how to advocate for their kids, but I also teach kids how to - [To Kill a Mockingbird: Themes & Symbols](https://schoolworkhelper.net/to-kill-a-mockingbird-themes-symbols/) - Themes Prejudice and RacismFear of the UnknownInnocenceComing of AgeCourageFamily relationships Prejudice The novel is set in the deep Southern state of Alabama in the mid-1930s. During the early days of freedom for the African-Americans. The climate was fraught with resentment that reflected people’s resistance toward the abolition of Slavery. Racial PrejudiceTrial of Tom RobinsonWrongly accused, - [THE CANADIAN “NEW DEAL”](https://schoolworkhelper.net/the-canadian-new-deal/) - Bennett by 1935 decided to adopt some of American President’s Franklin D. Roosevelt’s “New Deal” policies of 193. The New Deal (blueprints for the future) in the United States of America extended the influence of the federal government into the whole economic life of the country. New laws were passed that relieved the immediate distress - [Democracy vs. Autocracy](https://schoolworkhelper.net/democracy-vs-autocracy/) - Beliefs Central to Democracy: Decisions should reflect the will of the majorityGovernment is limited in its power and must respect people's rightsCitizens should have a voice in decision-makingAll citizens should have a sense of responsibility to other people and the communityCitizens should have a sense of what is socially just (good/fair for society) Elements of - [Contributions of Ancient People of the Fertile Crescent](https://schoolworkhelper.net/contributions-of-ancient-people-of-the-fertile-crescent/) - THE SUMERIANS: Invented the arch and built temples called ziggurats. Created the first written language called cuneiform. King Hammurabi of Babylon was the first ruler to record a set of written laws. It consisted of 282 laws and was displayed in the every town for all to see. THE BABYLONIANS: Contributed the Hanging Gardens of - [Major Accomplishments of the Ancient Greeks](https://schoolworkhelper.net/major-accomplishments-of-the-ancient-greeks/) - 1. They developed the world's first democracy.2. They were the first people to take the scientific approach to medicine by actually studying the diseases. (Hippocrates)3. Playwrights wrote and produced the first dramas in outdoor theaters. (Euripides & Sophocles)4. They invented the rules of Geometry as well as other mathematics. (Euclid)5. They developed the art of - [Contributions of Islam (During The Middle Ages)](https://schoolworkhelper.net/contributions-of-islam-during-the-middle-ages/) - 1. Protected and spread the knowledge of Ancient Greece, and made it accessible to Renaissance scholars and scientists. 2. Made new contributions in math, and the sciences and wrote influential works later discovered and used by Renaissance mathematicians and scientists. 3. Influenced the architecture of parts of Europe (Spain and parts of Italy) 4. Made - [Contributions of Ancient Rome](https://schoolworkhelper.net/contributions-of-ancient-rome/) - RELIGION Facilitated the spread of Christianity throughout the Empire. GOVERNMENT Democracy plus Senate (Members represented sections of society) LITERATURE Ovid: Metamorphoses, Virgil: Aeneid, Cicero: Rhetorical works. HISTORICAL WORKS Tacitus: Histories; Julius Caesar: Histories of Rome. CONSTRUCTION Marcus Vitruvius Pollio: “De architectura,” deals with urban planning, building materials, temple construction, public and private buildings, and hydraulics, - [Important Events and Dates in Modern European History](https://schoolworkhelper.net/important-events-and-dates-in-modern-european-history/) - 1341 (April 6) Petrarch crowned Poet Laureate. The Renaissance begins.1397: Giovanni de Medici Moves to Florence: Giovanni de Medici, the papal banker, settles in Florence and becomes a patron of the arts, beginning the Medici rule over Florence.1401: Ghiberti awarded the Right to Sculpt the Doors of The Baptistry in Florence: It takes him 28 - [Sentencing, Appeals, and Prison](https://schoolworkhelper.net/sentencing-appeals-and-prison/) - - Imposing a sentence is a difficult thing to do as there must be a balance between what is best for society and for the guilty party - After sentencing the party can appeal in a higher court - There are two ends to the pendulum . . . punish them … and treat them - [10 Things Not to Put in Your Resume](https://schoolworkhelper.net/10-things-not-to-put-in-your-resume/) - How much money you want Why you're changing jobs, or why you left a previous one Social Insurance Number Addresses of former employers Your age Marital Status Whether you have children, or are pregnant Height, Weight Health status or disabilities Race and/or Religion (if it is important to the job, put it in the cover - [What Are You Afraid Of? Fears and Phobias](https://schoolworkhelper.net/what-are-you-afraid-of-fears-and-phobias/) - PHOBIA. It's a fancy word for something that really freaks you out. No doubt about it. Indiana Jones has a phobia about snakes. What is a phobia? It's an extreme or unrea­sonable fear of something. About one in ten people have some kind of phobia. So, what causes phobias? There are many causes, but here's - [Hamlet: Appearance vs Reality](https://schoolworkhelper.net/hamlet-appearance-vs-reality/) - Claudius - Although King Claudius appears to be a kind, innocent ruler, he turns out to be the opposite. Instead, he is evil as demonstrated when he murders his own brother, King Hamlet. “O villain, villain, smiling, damned villain, My tables,-meet it is I set it down That one may smile, and smile, and be - [Betrayal in Hamlet](https://schoolworkhelper.net/betrayal-in-hamlet/) - Gertrude Gertrude betrays Hamlet and the late King Hamlet by marrying Claudius. Hamlet, being still depressed about his father’s death was further upset and felt betrayed by his mother when she quickly married Claudius. “Mother, you have my father much offended …You are the queen, your husband’s wife …” (3.4.10-15) By marrying her former husband’s - [Claudius’ Role and Personality in Shakespeare’s Hamlet](https://schoolworkhelper.net/claudius-role-and-personality-in-shakespeares-hamlet/) - Role in Play Important events he is involved in: Becomes the new King of Denmark by pouring poison in his brother’s ear in the garden, thus killing King Hamlet and overthrowing himMarries King Hamlet’s wife, Gertrude, abruptly after King Hamlet’s deathExposes his guilt at the play when the plot on stage resembles the events of - [Corruption in Hamlet](https://schoolworkhelper.net/corruption-in-hamlet/) - For the purpose of this assignment, corruption is defined as dishonesty or improper behavior, by a person in a position of authority. (The American Heritage School Dictionary, Hauton Miffin, Boston, USA, 1977). Corruption in Hamlet doesn’t exactly start out strong. It grows as the play goes along, seeping into the different character’s lives. The first - [Death in Hamlet](https://schoolworkhelper.net/death-in-hamlet/) - King Hamlet -King Hamlet’s death gets hamlet to take revenge on king Claudius -King Hamlets death leads to many people dying as he leads to his main target. Because of the revenge Hamlet is going to take. Haste me to know't, that I, with wings as swift As meditation or the thoughts of love, May - [Deceit in Hamlet](https://schoolworkhelper.net/deceit-in-hamlet/) - Claudius lies to the entire state of Denmark by killing King Hamlet. Analysis: This lie and act of deceit is a secret at the very beginning of the play since Claudius says King Hamlet died because of a snake bite. However, the ghost of the late King Hamlet informs Hamlet, and the audience, about the - [Fatality in Hamlet](https://schoolworkhelper.net/fatality-in-hamlet/) - The first sighting of fatality in Hamlet was the murder of King Hamlet. King Hamlet was murdered by his brother Claudius King Hamlet’s soul did not rest in peace and his spirit was back to tell the truth about murder Hamlet was devastated at how his innocent father had died, being the good man he - [Queen Gertrude Character Analysis (Hamlet)](https://schoolworkhelper.net/queen-gertrude-character-analysis-hamlet/) - Analysis #1 Gertrude is a character in the Shakespearian play Hamlet. She is the mother/aunt of Hamlet, and she is also the wife/ex-sister-in-law of King Claudius. In the play, Gertrude demonstrates many characteristics and traits as the play progresses. She is a very caring character when Hamlet is thinking about going back to Wittenberg for - [Good vs. Evil in Hamlet](https://schoolworkhelper.net/good-vs-evil-in-hamlet/) - Good Hamlet - Nobly gives his vote to Fortinbras “On Fortinbras: he has my dying voice; So tell him, with the occurrence, more and less, which have solicited. The rest is silence.” (V.2.346-348) Horatio Wants to kill himself when Hamlet is about to die - listens, very loyal HORATIO: Never believe it. I am more - [Hamlet: The Theme of Revenge](https://schoolworkhelper.net/hamlet-the-theme-of-revenge/) - Revenge is an evident theme in Shakespeare’s play, Hamlet. Hamlet is the main character seeking revenge in the play. o Hamlet is seeking revenge on Claudius because he kills his father, King Hamlet. The ghost of King Hamlet tells Hamlet to get revenge on Claudius for killing him. § “Revenge his foul and most unnatural - [Hamlet: Horatio Character Analysis](https://schoolworkhelper.net/horatio-character-analysis-hamlet/) - Character He is a friend of Hamlet’s from his school in Wittenberg. His role in the play is that he is Hamlet’s most loyal and trusted friend, despite his poor status. While Hamlet’s other friends, Rosencrantz and Guildenstern, turn on him, Horatio demonstrates his loyalty throughout the play. In the end, he is the only - [Immortality in Hamlet](https://schoolworkhelper.net/immortality-in-hamlet/) - Shakespeare’s message on Immortality is to make the characters wonder weather it is better to live suffering or die peacefully. He also displays elements of immortality through some living, and dead characters. The Ghost I do not set my life in a pin’s fee, And for my soul—what can it do to that, Being a - [Loyalty in Hamlet](https://schoolworkhelper.net/loyalty-in-hamlet/) - In William Shakespeare’s Hamlet, loyalty has a major effect on the way the plot unravels and displays the true nature of the characters. It is through their actions and the things they say where the audience discovers whether a character is loyal or disloyal. Some of the characters that display a sense of loyalty and - [Madness in Hamlet](https://schoolworkhelper.net/madness-in-hamlet/) - In Hamlet, by Shakespeare, the theme of madness is a prevalent theme that is portrayed through several characters in the play. The initial point at which madness is evident is when Hamlet is left to seek revenge upon the murderer of his father. Hamlet initiates his scheme to attain revenge in order to gain a - [Ophelia Character Analysis (Hamlet)](https://schoolworkhelper.net/ophelia-character-analysis-hamlet/) - Significance/ Role Noblewomen of Denmark Daughter of Polonius Sister of Laertes Hamlet’s love Character Traits and General Facts Ophelia demonstrates purity, the innocence and virtue of women She is childlike and naïve in nature She is unaware of the harsh realities of life Although she truly loves Hamlet, she is very loyal and obedient to - [Poison in Hamlet](https://schoolworkhelper.net/poison-in-hamlet/) - Claudius poisons many of the characters in Hamlet both literally and metaphorically: Almost all of the poisoning is Claudius’ fault Literally: Poison is used in Claudius and Laertes’ plot to kill Hamlet Laertes’ sword has poison on it, and Hamlet’s drink is also poisoned in case Laertes can’t kill him “I’ll have prepar’d him A - [Hamlet: Polonius Character Analysis](https://schoolworkhelper.net/polonius-character-analysis-hamlet/) - Role: Father of Leartes and OpheliaCourtier to late King Hamlet and present King Claudius He plans for Ophelia and Hamlet to meet in the hall, so he can find out the reason behind Hamlet’s madness.Sends Reynaldo to spy on his son Leartes, in Paris.Plans with King Claudius to hide and spy on Hamlet when he - [Sanity vs. Insanity in Hamlet](https://schoolworkhelper.net/sanity-vs-insanity-in-hamlet/) - How sanity affects Hamlet, its characters and plot: Sanity Hamlet faking his insanity Horatio’s continuous support seems to keep Hamlet from falling off the brink Ophelia’s death brings an end to Hamlet’s facade, and he confronts Claudius and Laertes Laertes learned to think clearly during his fight with Hamlet Insanity Ophelia driven crazy by father’s - [Secondary Plots in Hamlet](https://schoolworkhelper.net/secondary-plots-in-hamlet/) - The secondary plot of the story refers to the events that are taking place in Denmark in addition to those of the main plot. At times the secondary plot supplements the main plot of the story by providing a sense of urgency and becomes the subject of Dialogue in parts of the play. The secondary - [Hamlet’s Self-Discovery](https://schoolworkhelper.net/hamlets-self-discovery/) - Definition: The act or process of achieving understanding or knowledge of oneself; or becoming aware of one's true potential, character, motives, etc. Throughout the play, Hamlet’s complicated path to self-discovery is demonstrated though: His soliloquies His attitude toward other characters Hamlet is known to continuously question himself through his soliloquies, which shows he has lost - [Important Symbols in Hamlet](https://schoolworkhelper.net/important-symbols-in-hamlet/) - Poison Poison plays a big role in Hamlet. It is a symbol of betrayal, corruption, deceit, revenge and death. In Act 1 Scene 5, Hamlet follows the ghost of his father, King Hamlet and learns the entire story of how Claudius kills him. King Hamlet says, “…Upon my secure hour thy uncle stoleWith juice of - [Setting, Atmosphere, Mood in Hamlet](https://schoolworkhelper.net/setting-in-hamlet/) - Setting In Hamlet, there are numerous references made to other countries which include France, Germany, Norway, Poland, and England. Despite these locations, the majority of the play occurs in and around Elsinore Castle, located in Denmark. Elisnore is better known as Helsingoer to the Danish population and to Shakespeare enthusiasts and the English, it is - [What are Archetypes in Literature](https://schoolworkhelper.net/what-are-archetypes-in-literature/) - An archetype is an original model which something is patterned or based on. This term is often used in literature, architecture and the arts to refer to something that goes back to the fundamentals of the art. Psychologist Carl Jung described several archetypes that are based on the observation of differing but repeating patterns of - [Bloom's Taxonomy of Learning Domains](https://schoolworkhelper.net/blooms-taxonomy-of-learning-domains/) - The Three Types of Learning There is more than one type of learning. A committee of colleges, led by Benjamin Bloom (1956), identified three domains of educational activities: Cognitive: mental skills (Knowledge) Affective: growth in feelings or emotional areas (Attitude) Psychomotor: manual or physical skills (Skills) Since the work was produced by higher education, the - [Types of Housing Definitions](https://schoolworkhelper.net/types-of-housing-definitions/) - Apartment An apartment, or flat, is a self-contained housing unit that occupies only part of a building. Your rent usually includes payment for the management of the common areas. Condo/Condominium Individual ownership of a portion of a building, with common areas shared by all owners. Often condo's have all the amenities included in the unit - [Introduction to Psychology](https://schoolworkhelper.net/introduction-to-psychology/) - What is psychology? Psychology is the scientific study of behaviour and mental processes. This definition of psychology reflects its concern with an objective study of observable behaviour. It also recognizes the importance of understanding mental processes that cannot be directly observed but must be inferred from behavioural and neurological data. Approaches to psychology There are - [Introduction to Sociology](https://schoolworkhelper.net/introduction-to-sociology/) - The social sciences examine human relationships. Just as the natural sciences attempt to understand the world of nature, the social sciences attempt to understand the social world. Just as the world of nature contains ordered relationships that are not obvious but must be discovered through controlled observation, so the ordered relationships of the human or - [Language & the Brain](https://schoolworkhelper.net/language-the-brain/) - Broca’s Area: portion of the left cerebral hemisphere involved in the control of speech. Wernicke’s area: portion of the left cerebral hemisphere involved in the language understanding. If damage were to occur to each area how would this effect an individuals language and speech? Language Aphasia: is used to describe language deficits caused by brain - [World Trade Definitions](https://schoolworkhelper.net/world-trade-definitions/) - Austrian School (also Vienna School): A school of economics that emphasizes free markets, individual property rights, and freedom of association. It also calls for the abolition of central banks and a return to the gold standard. The school is based on principles postulated by the Austrian economist Carl Menger in the late 19th century. Boom - [Types of Globalization](https://schoolworkhelper.net/types-of-globalization/) - Financial globalization Interconnection of the world’s financial systems e.g. stock marketsMore of a connection between large cities than of nationsExample: What happens in Asian markets affects the North American markets. Economic Globalization A worldwide economic system that permits easy movement of goods, production, capital, and resources (free trade facilitates this)Example: NAFTA, EU, Multinational corporations Technological - [Music of the Renaissance](https://schoolworkhelper.net/music-of-the-renaissance/) - The Middle Ages--the period directly preceding the Renaissance--saw the use of music for specific purposes. This included songs used to accompany knights riding into battle, songs for working, for dancing, and most notably for religious ceremony. The majority of this music has been lost. Only church music survived because only men of the church were - [Tripartite Man: Body, Spirit, Soul](https://schoolworkhelper.net/tripartite-man-body-spirit-soul/) - In the early Christian era, man was believed to be composed of two parts: he was half animal and half angel. His animal nature drew him to sin; his angelic spirit provided him with a conscience, and gave him his faith and knowledge of god. Life was seen as a great testing ground where the - [Themes in King Lear](https://schoolworkhelper.net/themes-in-king-lear/) - Evil and Justice The division among 20th Century critics in their interpretations suggests that Shakespeare may have left it to his audiences to provide the answer to the problem of good and evil. It is possible to isolate passages, each of which seems to provide an answer. Kent, placed in the stocks at the order - [The Chain of Being Shakespeare](https://schoolworkhelper.net/the-chain-of-being-shakespeare/) - Definition and Explanation Concept: “everything in the world has its own place”No matter what you do, you cannot make your way up in the chainYou are all that you are born with, for the rest of your life, no matter what you do to try and change itThe English society depended on a certain “order”: - [Niccolo Machiavelli and the Prince](https://schoolworkhelper.net/niccolo-machiavelli-and-the-prince/) - Biography Niccolo Machiavelli is one of the major political philosophers of our times. He was an Essayist, dramatist historian, sketch writer, biographer, dialogist, writer of novellas and a poet. Machiavelli was born on May 3rd,1496, in a family of a Doctor of Law, in Florence Italy. In 1498 he helped to dispose of Giroiamo Savonarola - [Adolf Hitler on the Annihilation of the Jews](https://schoolworkhelper.net/adolf-hitler-on-the-annihilation-of-the-jews/) - Anti-Semitism as a political movement should not and cannot be determined by factors of sentiment, but only by the recognition of the facts. These are the facts: To begin with, Jewry is unqualifiedly a racial association and not a religious association. . . . Its influence will bring about the racial tuberculosis of the people. - [The Holocaust Chronology 1933-1945](https://schoolworkhelper.net/the-holocaust-chronology-1933-1945/) - 1933 January 30 --Hitler is appointed Reich Chancellor of Germany by Hindenburg January 30 -- Sterilization (of inferiors) Laws enacted; implemented three weeks later February 27 -- Reichstag fire February 28 -- Leading communists arrested March 20 -- Dachau concentration camp established April 1 -- General boycott of all Jewish businesses - One day April - [The Globe Theatre](https://schoolworkhelper.net/the-globe-theatre/) - Globe Theatre- Plays When a play was written, it was quickly produced. Rival play making companies would send their members to get unauthorized copies of the plays, they were called Quarto Texts. Globe Theatre- Actors Women weren’t allowed to be in plays because they thought men brought in better audience and that it was too - [Shakespeare London and the Black Death](https://schoolworkhelper.net/shakespeare-london-and-the-black-death/) - The Black Death – victims die in 2 to 4 days -rats fleas carried the disease -once the rats died out humans became new victims Symptoms of the Black Death Include - painful swelling - mental disorientation - vomiting - bleeding - high fever - desire to sleep (if they did, it was fatal) Began - [William Shakespeare Biography](https://schoolworkhelper.net/william-shakespeare-biography/) - William Shakespeare was born on April 23rd, 1564 and died on April 25th, 1616. Both of his parents were uneducated. When W.Shakespeare was four years of age, he went to a private school for both boys and girls. He was educated in Latin and Greek. His school days often started from dawn till dusk. W. - [Elizabethan Beliefs](https://schoolworkhelper.net/elizabethan-beliefs/) - Religion The major two religions in Elizabethan England were Catholic and Protestant religions, Choosing the "wrong" religion brought risks to personal wealth, freedom, and lifeSchools taught these “favored” religions; if you did not practices these religions then it would lead to great danger: Imprisonment, Torture. ExecutionCatholics believed that the pope or the priest could forgive - [Queen Elizabeth Biography](https://schoolworkhelper.net/queen-elizabeth-biography/) - Queen Elizabeth was born on September 7th 1533 at Greenwich Palace. She was the daughter of Anne Boleyn who was the second wife of King Henry VIII. The king hoped for a son after having a daughter. Queen Elizabeth’s mom was arrested, charged with a many crimes, and executed on 19 May 1536. Just 12 - [Canadian Life in the 1900s](https://schoolworkhelper.net/canadian-life-in-the-1900s/) - Country of Economic Contrasts 1st millionaires appear Cities have slums Stark contrast between the rich and the poor (upper and lower class) 1/4 + of babies die before their 1st birthday New technology makes life easier (for those who can afford the luxury) Technology in the Home 1900s was a time of “gadgets” New “gadgets - [The Cold War: Events & People](https://schoolworkhelper.net/the-cold-war-events-people/) - The Cold War Intensifies (327) August 29th, 1949: Soviet Union detonates an atomic bomb at a test site in Siberia Military balance shifts: both sides in the Cold War have nuclear weapons This triggers an arms race to develop more powerful thermonuclear weapons (hydrogen bombs) 1952: United States detonates world’s first hydrogen bomb 1953: Soviets - [Life in 1950’s – The War Comes to a Close](https://schoolworkhelper.net/life-in-1950s-the-war-comes-to-a-close/) - For Canadians, the late forties and early fifties marked the return to a normal family lifeSeveral hundred thousand Canadian veterans returned home after serving in the war effort overseasSome soldiers returned home to their families – others brought home their war brides and their children93% were British, 7% were from Italy, Belgium, Scottish, Danish, etc.In - [The “Quiet Revolution”: Quebec and Canada (1914 -1945)](https://schoolworkhelper.net/the-quiet-revolution-quebec-and-canada-1914-1945/) - Each of the two twentieth century world wars had brought with it domestic tension related to the issue of conscription. There had been passionate opposition to conscription in Quebec in 1917 and again in 1944. After 1945 Quebec-Canada relations appeared to be relatively calm but problems remained very close to the surface. The Problems of - [World War 1 Trench Warfare: Life in the Trenches](https://schoolworkhelper.net/world-war-1-trench-warfare-life-in-the-trenches/) - Daily life in the trenches Schlieffen Plan: Germany quickly advanced through Belgium and into Northeast France and began push for Parisian assault Battle of the Marne – French, Belgian and British troops fight the Germans and push them back to Aisne. It was a clear Allied victory, with gained ground though heavy casualties Importance: Loosing - [Battle of Britain](https://schoolworkhelper.net/battle-of-britain/) - Hitler’s belief: after Norway, Denmark, Poland, Luxembourg, Belgium, Holland and France fell into German hands, Britain would only naturally be so scared after being thrown out of Europe that it would beg for surrender. Two options: Limited military action, propaganda and political warfare An actual invasion July 10, 1940: Operation Sea lion – an invasion - [Guide to Surviving an Interview](https://schoolworkhelper.net/guide-to-surviving-an-interview/) - Don’t stress – be prepared! Before the Interview Learn as much as possible about the job you are interviewing for. See if the company has a website – a great source of information Think of three questions you may want to ask the interviewer about the job Do a self-inventory of your personal strengths and - [Basic Electronics](https://schoolworkhelper.net/basic-electronics/) - Understanding Electricity Everything inside or attached to the PC system unit runs on electricity. Electricity is both the lifeblood and the mysterious evil of the personal computer. It's a flowing entity, measured in amps, ohms, and volts that should be approached with respect, if not outright fear. Electricity flowing through a circuit is very much - [The Development of Computing 1951 - 2001](https://schoolworkhelper.net/the-development-of-computing-1951-2001/) - First Generation Computers 1951 - 1959 • Vacuum tube logic. • Magnetic drum or tape storage. • Punched cards used for data inputs. • Programmed in machine language. • Large, slow and expensive. Second Generation Computers 1959 – 1963 • Discrete transistors replace vacuum tubes. • Magnetic core used for main memory. • Magnetic disk - [Computer Hardware Safety Rules](https://schoolworkhelper.net/computer-hardware-safety-rules/) - When installing or removing computer hardware and other peripherals : 1. Wear proper apparel. Avoid acrylic or wool sweaters when working with electronic parts. Do not wear loose-fitting clothing, rings, bracelets etc. 2. Unplug all computer equipment and peripherals before opening any cases. (The only exception to this is if you were working without an - [Types of Computers & Parts](https://schoolworkhelper.net/types-of-computers-parts/) - Hardware vs. Software Hardware is the physical equipment directly involved in the performance of data-processing or communications functions.Software is the programs, routines, and symbolic languages that control the functioning of the hardware and direct its operation. Definition of a computer A computer is a programmable machine that stores, retrieves, and processes informationA Personal Computer is - [Computer Components and Specifications](https://schoolworkhelper.net/computer-components-and-specifications/) - Motherboard The motherboard is the main circuit board of a computer.EVERYTHING in a computer system is connected to it!!!Produced in a variety of sizes (a.k.a. form factor) Components The following are components that are typically connected to a motherboardCPUHard DriveOptical Drive (DVD, CD, etc)þRAMVideo CardPower supplyA motherboard contains the following slots, sockets, and connectors for - [Computer Software and Types](https://schoolworkhelper.net/computer-software-and-types/) - Software is the programs, routines, and symbolic languages that control the functioning of the hardware and direct its operation. Types of Software Retail Software type of software is sold off the shelves of retail stores. includes expensive marketing and packaging designed to catch the eye of shoppers generally more expensive OEM Original Equipment Manufacturer designed - [Computer Networks and Components](https://schoolworkhelper.net/computer-networks-and-components/) - Definition A computer network is a number of computers linked together to enable them to share computing resources. Networks can be permanent (via cables) or temporary (via modem) The sharing of resources through a network can also be local or global Networks allow different types of computers to communicate. Benefits Information can be accessed in - [Computer Communication Channels and Cables](https://schoolworkhelper.net/computer-communication-channels-and-cables/) - Definition In a network, a communication channel is a physical path the transmission signals travel. It is the path information travels from computer to computer.How do the computers in a network “connect” to each other. The 5 communication channels twisted-pair cablescoaxial cablesfiber optic cablesterrestrial stationscommunication satellites Twisted pair cables Signals are transmitted using pairs of - [The Internet: History and Components](https://schoolworkhelper.net/the-internet-history-and-components/) - The Internet Large sprawling network on a global scale. A very large sprawling Wide Area Network A network of many networks A little History… 1960’s Advance Researh Projects Agency (ARPAnet) is a system of linked mainframes Developed by military to ensure communication in times of crisis 1980’s MILNET splits from ARPAnet to form the Internet - [ASCII: American Standard Code for Information Interchange](https://schoolworkhelper.net/ascii-american-standard-code-for-information-interchange/) - Recall: Computers communicate using binary Therefore, computers do NOT process information using characters (e.g. letters). Each letter or character has a number representation that the computer uses to refer to the character. ASCII: American Standard Code for Information Interchange ASCII is a code for representing English characters as numbers. The ASCII numbers range from 0 - [Amerigo Vespucci Biography](https://schoolworkhelper.net/amerigo-vespucci-biography/) - Vespucci was the one person for whom North and South America was named after. Vespucci had a wonderful life and found many things on his voyages. Amerigo Vespucci was born in Florence, Italy in March of 1451, and grew up in a considerable mansion near the river. As a young boy, Amerigo's happiest moments studying - [Slavery in the Early Settlements](https://schoolworkhelper.net/slavery-in-the-early-settlements/) - The Origins of the Minority Groups in America Native Americans - As the settlers took over the land, the Natives went through back- breaking work done on farms - Conquistadors forced Natives to work for a tax - Slave-like existence - Working conditions in gold and silver mines were unsanitary, dark, cave-like - Diseases spread: - [The American Voting System: Electoral College](https://schoolworkhelper.net/the-american-voting-system-electoral-college/) - The American voting system elects legislators based on one geographical district; by majority or plurality (whoever gets the most votes in that district wins). The districts are whole states for Senators and parts of states for House members. This is known as the "First-past-the-post" system. In the parliamentary system, all legislators are elected at-large, meaning - [The Articles of Confederation and the Constitution](https://schoolworkhelper.net/the-articles-of-confederation-and-the-constitution/) - Deficiencies in the Articles of Confederation No separate executive branch to carry out the laws of Congress. No national judiciary to handle offenses against the central government's laws or to settle disputes between states. Congress did not have the power to levy taxes. Congress could not regulate interstate and foreign commerce. The states as well - [The Mayflower Compact (1620)](https://schoolworkhelper.net/the-mayflower-compact-1620/) - The settlers who came to the New World brought with them a great deal of baggage in the form of ideas and beliefs they had held dear in England. Indeed, many of them, such as the Puritans, came to America so they could live in stricter accord with those beliefs. The Pilgrims, a branch of - [What is the Electoral College?](https://schoolworkhelper.net/what-is-the-electoral-college/) - Summary: Americans elect the President and Vice-president through a method of indirect popular election. On November 2, 2004, voters cast their ballots for a presidential candidate. However, votes actually count towards a group of electors who pledge to vote for a specific candidate when the Electoral College meets in December. The "Electoral College" is the - [Slavery: 1700s until present](https://schoolworkhelper.net/slavery-1700s-until-present/) - The Rise of Coastal Empires - Around 1700, Asante (or Ashanti) Empire of Akan peoples was unified under Osei Tutu on the "Gold Coast". Asante dominated the coast with control of gold-producing zones and by supplying slaves in exchange for firearms (to 1820s). - The Ashanti, who resisted British Imperialism in a Hundred Years War, - [Tort and Negligence](https://schoolworkhelper.net/tort-and-negligence/) - Negligence: Act is unintentional Act is unplanned Act results in an injury Intentional tort: a person deliberately causes harm/loss to another person (trespassing, causing a nuisance, defaming property). It must include - Intent Foreseeability (realization that an accident could occur) Elements of Negligence Duty of care: a legal obligation to not harm other people or - [Assault, Sexual Assault, Amber Alerts](https://schoolworkhelper.net/assault-sexual-assault-amber-alerts/) - Assault Assault: intent is the key – if the act was brought about due to carelessness or reflex, then there is no assault A threat can be considered assault if the action is able to be carried out at the same time Types of assault The issue of consent Giving consent: agreeing to the sexual - [What is a drug? Drug offences, possession, crimes](https://schoolworkhelper.net/what-is-a-drug-drug-offences-possession-crimes/) - What is a drug? Any substance that by its chemical nature alters structure or function in a living organism Legal – tea, coffee, coca cola, aspirin, Illegal – cocaine, LSD, heroin Controlled Drugs and Substances Act Enacted in 1997 Criminalizes possession of, and trafficking in, of a variety if illegal and controlled drugs Schedule I: - [Arrest: Types of Arrest, Being Arrested](https://schoolworkhelper.net/arrest-types-of-arrest-being-arrested/) - The purpose of Canadian law: to protect Canadian society by trying to balance investigative/arrest rights of the police with the individual rights and freedoms of society. To arrest someone, the police must: Determine that an offense has been committed Have reasonable grounds to believe that the suspect committed the offense 3 ways to apprehend: An - [Reaching a Verdict, Sentencing and Releasing](https://schoolworkhelper.net/reaching-a-verdict-sentencing-and-releasing/) - Reaching a verdict After the Crown and defence make their cases, it is time for the judge and/or jury to reach a decision about the guilt of the accused Charge to the jury: judge reviews the law applying to the case, how certain evidence should be weighed, there needs to be intent etc. Deliberation Jury - [Sikh Festivals: Gurpurb, Jore Melas, Baiskhi, Diwali, Hola Mohalla](https://schoolworkhelper.net/sikh-festivals-gurpurb-jore-melas-baiskhi-diwali-hola-mohalla/) - Festival Descripton Gurpurb - connects to the lives of Gurus - a holy day that connects to the birth or death of one of the Gurus…the birthday of Guru Nanak is called Gurpurb…most imp holy day, usually in November - continuous reading of Sahib for 48 hrs is called Akhand Path…many info sessions on this - [Sikh Milestones: Birth, Amritsanshkar, Marriage, Funerals](https://schoolworkhelper.net/sikh-milestones-birth-amritsanshkar-marriage-funerals/) - Milestone Short Description Birth A few wks after the child is born, parents present the child to the sacred text Guru Granth Sahib They bring ROMALA (a pc of embroidered material to the Sahib), and money The Granthi, offers Ardas, prayers and blessings NAMING CEREMONY (Nam Karam), the Sahib is opened at random, a hymn - [Fetal Pig Dissection Manual](https://schoolworkhelper.net/fetal-pig-dissection-manual/) - Procedure Part 1 - External Anatomy Identify and record the 4 main body segments Examine the head of your pig Note the eyes. Each eye is protected by three eyelids! The third eyelid is the nictitating membrane – a small mass of tissue in the corner of each eye. Part 2 - Internal Anatomy Be - [The Tempest: Characters, Symbols, Themes](https://schoolworkhelper.net/the-tempest-characters-symbols-themes/) - Context The Tempest was probably written in 1610–1611 and was first performed by the King’s Men in the fall of 1611.The Tempest is most likely the last play written entirely by Shakespeare, and it is remarkable for being one of only two plays by Shakespeare whose plot is entirely original.Because of its theme of a - [Physical Anthropology](https://schoolworkhelper.net/physical-anthropology/) - - Most people look to religion to explain human existence, the origin of the universe, and the meaning of existence However many theories from science have surfaced over the past 150 years… - The Theory of Evolution states that human ancestry is from lower life forms - Many paleontologists have overwhelming fossil evidence that supports - [Antisocial Personality Disorder (ASPD)](https://schoolworkhelper.net/antisocial-personality-disorder-aspd/) - What Is Antisocial Personality Disorder (ASPD)? a personality disorder/psychological mental illness that involves disregard for the rights or others, as well as impulsive, irresponsible and aggressive behaviour. Incidence in the population 3% in males and 1% in females. It is seen in 3% to 30% of psychiatric outpatients. even higher in prisons (80-85%). higher among - [Avoidant Personality Disorder (APD)](https://schoolworkhelper.net/avoidant-personality-disorder-apd/) - Avoidant Personality Disorder (APD) is a condition characterized by extreme shyness, feelings of inadequacy, and sensitivity to rejection. Causes: Avoidant Personality disorder usually appears in early childhood with signs of excessive shyness when the child is faced with new situations and new people. This disorder may also be influenced by a combination of social, genetic, - [Dependent Personality Disorder](https://schoolworkhelper.net/dependent-personality-disorder/) - Dependent personality disorder is individuals that rely on others that lead to clinging and submissive behaviours, and are afraid of separation. For example: a man in his mid-20 had experienced difficulty at work; socially because he needed so much attention. He was always depressed and anxious about failures and by the way he spoke, you - [Narcissist Personality Disorder](https://schoolworkhelper.net/narcissist-personality-disorder/) - Definition aggregated sense of self- importance look for constant attention fragile self-esteem and are vulnerable to the slightest criticism Incidence in the population 2% to 16% of the population in clinical settings have this disorder in 1994, 18% of the students supposed to have narcissism in 2009 when the test was redone, 34% of the - [Paranoid Personality Disorder](https://schoolworkhelper.net/paranoid-personality-disorder/) - Definition A disorder that includes the patient to be mistrusting and suspicious of others at all times. This diagnosis is chronic and lifelong and no cure has been found. Patient goes through various forms of this diagnosis which vary from person to person. Statistics NESARC 43,000 American Adults 2001-2002 Met the Diagnostic 4.4% 2009 Population - [Schizotypal Personality Disorder](https://schoolworkhelper.net/schizotypal-personality-disorder/) - Definition Schizotypal personality disorder is characterized by an ongoing pattern in which the affected person distances him- or herself from social and interpersonal relationships. A person with Schizotypal personality disorder has odd behaviors and thoughts that would typically be viewed by others as eccentric, erratic, and bizarre. Incidence in the Population Prevalence of Schitzotypal disorder - [Abraham Maslow: Biography and Hierarchy of Needs](https://schoolworkhelper.net/abraham-maslow-biography-and-hierarchy-of-needs/) - Born April 1st – 1908 in Brooklyn, NY. Eldest of seven siblings, born to uneducated Jewish immigrant parents from Russia. Parents pushed him hard for academic success. He studied law at the CCNY (city college of New York) and after three semesters, he transferred over to Cornell, then back to CCNY. Maslow ended up marrying - [Sigmund Freud Biography: 1856 - 1939](https://schoolworkhelper.net/sigmund-freud-biography-1856-1939/) - Sigismund (later changed to Sigmund) Freud Freud was an Austrian neurologist and the founder of psychoanalysis, who created an entirely new approach to the understanding of the human personality. He is regarded as one of the most influential - and controversial - minds of the 20th century. Sigmund Freud was born on May 6, 1856 - [Alfred Adler Biography & Contributions](https://schoolworkhelper.net/alfred-adler-biography-contributions/) - Autobiography & Field of Research Alfred Adler was born on February 7th 1870 in Vienna Austria. He was the second out of seven children of a Hungarian born grain merchant. As a child he developed rickets and was unable to walk until the age of four. At the age of five he was diagnosed with - [Carl Jung Biography](https://schoolworkhelper.net/carl-jung-biography/) - Biography Carl Jung was born in Thurgau Switzerland July 26 1875 and died June 6th 1961 at the age of 85. Carl Jung was born Karle Gustav II Jung in Kesswil, in the Swiss canton (or county) of Thurgau, as the fourth but only surviving child of Paul Achilles Jung and Emilie Preiswerk. His father - [The Life and Work of Ivan Pavlov](https://schoolworkhelper.net/the-life-and-work-of-ivan-pavlov/) - His Personal Life Ivan Petrovich Pavlov was born September 14, 1849 in the tiny village of Ryazan in Central Russia. He was born into a very religious family, the eldest of 10 children. His father, Peter Dmitrievich Pavlov was the village priest, and his mother Varvara Ivanovna Pavlova, was the daughter of a priest. With - [Jean Piaget Biography](https://schoolworkhelper.net/jean-piaget-biography/) - Schemas – the representation in the mind of a set of perceptions, ideas, and/or actions, which go together Assimilation – putting a new object into an old schema Accommodation - putting an old object to a new schema Conservation – objects or sets of objects stay the same even if it changes or looks different - [John B. Watson Biography and Contributions](https://schoolworkhelper.net/john-b-watson-biography-and-contributions/) - John Broadus Watson John B. Watson was an important contributor to classical behaviorism. He is often known as the “father of behaviorism”, which paved the path for B.F Skinner. He was a professor of psychology at Johns Hopkins University. He is also listed as one of the most influential psychologists of the twentieth century, although - [Karen Horney Biography and Contributions](https://schoolworkhelper.net/karen-horney-biography-and-contributions/) - She was born in September 16, 1885 and died in December 04, 1952. She is Specialized In sexuality. She married a law student Oscar Horney in 1909. She graduated from university of Berlin in 1913 as a medical student. She taught psychoanalysis at university of Berlin and New York medical college. She is one of - [Noam Chomsky Biography and Contributions](https://schoolworkhelper.net/noam-chomsky-biography-and-contributions/) - At a young age… Noam Chomsky was born in Philadelphia, the older son of a professor of Hebrew who had emigrated from Russia in 1913. From early childhood he always displayed linguistic carefulness At 10 he was able to read his father's edition of a Hebrew grammar of the 13th century School life… In 1945 - [Wilhelm Wundt: Biography and Contributions](https://schoolworkhelper.net/wilhelm-wundt-biography-and-contributions/) - Introduction: Real name: Wilhelm Maximilian WundtWas a German medical doctor, psychologist, physiologist, and professor.Widely known as the father of experimental psychologyStudied at many universities in Germany especially in medicinethe first one in history to be called a 'psychologist' Best Known for: VoluntarismIntrospection (observation or examination of one's own mental and emotional state, mental processes)Establishment of - [Mental Disorders: Types and Causes](https://schoolworkhelper.net/mental-disorders-types-and-causes/) - What is “abnormal”? Mental disorders are characterized by abnormal behaviour, thoughts and feelings “abnormal” – any departure from the norm (different) Examples?? Pejorative connotation – characteristics we dislike or fear Behaviour is maladaptive Causes distress or discomfort, often interfere with people’s ability to lead useful, productive lives, make it impossible for people to hold jobs, - [George Orwell “Shooting An Elephant”: Metaphors and Analysis](https://schoolworkhelper.net/george-orwell-shooting-an-elephant-metaphors-and-analysis/) - George Orwell immediately begins the essay by first claiming his perspective on British Imperialism. He claims that it is evil and he is fully against the oppressors, the British. Though he is a British officer himself at the time in Burma, he feels a certain hatred and guilt towards himself, his empire, and the “evil-spirited - [WW1 Trench Slang](https://schoolworkhelper.net/ww1-trench-slang/) - All soldiers in all wars have come up with their own terms and phrases to describe what they do and see. Blighty/ A Blighty term for England or “old Blighty” a wound that does not kill but is bad enough to get you sent to England (Blighty) for treatment/sent home The Hun German Soldier – - [The British Empire & the Victorian Era](https://schoolworkhelper.net/the-british-empire-the-victorian-era/) - The British Empire A former collective term for the territories under the leadership or control of the British crown, including those in the Commonwealth of Nations and their colonies, protectorates, dependencies, and trusteeships (including the Dominion of Canada, Australia, India, & much of Africa) “Why does the sun never set on the British Empire?” “Because - [Extreme Weather: Thunderstorms, Tornadoes, Hurricanes, Blizzards, Floods](https://schoolworkhelper.net/extreme-weather-thunderstorms-tornadoes-hurricanes-blizzards-floods/) - THUNDERSTORMS - Thunderstorms are the most common type of storm. - These bring heavy rain, thunder, lightning, hail, and the odd tornado. - Two conditions must exist for a thunderstorm to form: Moisture is needed to form clouds and rain.Warm air must be pushed up in the atmosphere to form large cumulus clouds - As - [Forecasting and Measuring Weather](https://schoolworkhelper.net/forecasting-and-measuring-weather/) - - Forecasting weather can be difficult because there are many factors involved in weather such as the motion of air and water masses. - Weather forecasters (meteorologists) use complex computer models, weather instruments, and observations of weather patterns to predict the weather. - However, through careful observation, weather can be predicted by any individual. - - [PROFESSIONAL FORECASTING AND TECHNOLOGY](https://schoolworkhelper.net/professional-forecasting-and-technology/) - - People who study weather and make weather forecasts are called meteorologists. - Meteorologists use advanced technologies like satellites, weather balloons, radar, and computers to forecast weather. CHANGING TECHNOLOGIES - Before 1980, weather forecasts were only accurate for one day due to a lack of technology. - Now, weather forecasts are usually accurate for 3-5 - [What is Humidity? Water in the Air!](https://schoolworkhelper.net/what-is-humidity-water-in-the-air/) - Humidity is the measure of how much water vapour is in the air and is measured using a hygrometer. When humidity is low (therefore little water vapour in the air), moisture on our skin evaporates easily making us feel comfortable. When humidity is high (therefore a large amount of water vapour in the air), moisture - [What is the Coriolis Effect? How does Coriolis Effect work?](https://schoolworkhelper.net/what-is-the-coriolis-effect-how-does-coriolis-effect-work/) - The earth makes one complete rotation on its axis every 24 hours. An object on the equator travels the circumference of the globe (approximately 40,000 km) each day. Objects at the Poles simply rotate around a vertical axis but don't move in space. The distance traveled per day (and velocity of rotation) decreases with increasing - [Significant Digits Rules](https://schoolworkhelper.net/significant-digits-rules/) - The number of significant digits in an answer to a calculation will depend on the number of significant digits in the given data, as discussed in the rules below. Approximate calculations (order-of-magnitude estimates) always result in answers with only one or two significant digits. When are Digits Significant? Non-zero digits are always significant. Thus, 22 - [Musculoskeletal System Function and Components](https://schoolworkhelper.net/musculoskeletal-system-function-and-components/) - Planes of the Body ~ 200 bones in the body Supports the muscles Three other vital functions: Protection Blood-cell production Mineral Storage Protection Protect organs in the body (i.e. the skull protects the brain and the ribs protect the lungs) Blood-Cell Production In the bone marrow they produce blood cells (red, white and plasma) and - [Galaxies and Star Clusters](https://schoolworkhelper.net/galaxies-and-star-clusters/) - GALAXIES - A galaxy is an extremely large area of space that contains billions and billions of stars along with gases and dust. - Our solar system belongs to the “Milky Way Galaxy.” The Milky Way Galaxy is approximately 100 000 light years wide. This means if a light was turned on at one end - [Other Objects in the Solar System](https://schoolworkhelper.net/other-objects-in-the-solar-system/) - - Since the universe is so incredibly large, astronomers (scientists who study space) are constantly discovering new objects in the universe. - Even our solar system is incredibly large and contains countless objects. PLANETS AND THEIR MOONS - Planets are only some of the objects in our solar system. - Most of the planets (6 - [The Origin of the Universe](https://schoolworkhelper.net/the-origin-of-the-universe/) - It’s difficult to imagine, but they was once a time when our planet, our Sun, and our solar system did not exist. Where did everything come from? This is a very difficult question to answer, and many people (depending on their beliefs) have different ideas or theories to answer this question. Scientists who study the - [The Planets of the Solar System](https://schoolworkhelper.net/the-planets-of-the-solar-system/) - - Just like the Earth, all the planets in the solar system (there are eight of them) rotate around their axes (therefore the planet’s day) and revolve around the Sun (therefore the planet’s year). - Planets revolve in a certain path around the Sun called an “orbit.” An “orbital period” is the time it takes - [The Sun: An Important Star](https://schoolworkhelper.net/the-sun-an-important-star/) - Most of the small twinkling lights in the sky at night are stars so far away from the Earth that you would never be able to get to them even if you travel at the speed of light (300 000m/s) for your entire life! The closest star to our planet is only 150 million kilometers - [What can we see in the sky? Star Constellations](https://schoolworkhelper.net/what-can-we-see-in-the-sky-star-constellations/) - - Astronomy is the study of the outer space outside of our planet. - It includes objects such as planets, moons, stars, comets and meteors, and uses instruments such as telescopes, satellites and space shuttles. - When you look up into the night sky, you can see various bright objects, most of which are stars. - [Physical and Chemical Properties](https://schoolworkhelper.net/physical-and-chemical-properties/) - - All pieces of matter have properties or characteristics. All matters can be talked about with descriptive terms. For example, describe the Johnson uniform: - Scientists have grouped properties into two categories: physical properties and chemical properties. - The properties you just described when talking about the Johnson uniform are what scientists call “physical properties.” - [Models of Matter: Particle Model](https://schoolworkhelper.net/models-of-matter-particle-model/) - Up to now, we’ve been looking at how matter reacts and changes on a large scale. Now, we’re going to examine why matter changes. To do this, we need to break matter down into its smallest units to understand how it works. THE PARTICLE MODEL All matter can be broken down into smaller pieces until - [Classifying Matter](https://schoolworkhelper.net/classifying-matter/) - A way to classify matter is to divide it into synthetic and natural materials. Natural materials are those found in nature. For example: wood, cotton (cotton grows on plants), rocks, wool, eggs, and even human beings. These materials are not made in a factory or a laboratory. Synthetic materials are those that are man-made. They - [Physical and Chemical Changes](https://schoolworkhelper.net/physical-and-chemical-changes/) - - In order to get many chemicals to function the way we want them to, we need them to change. Example: no one would eat a raw hamburger. By applying heat to the ground beef, it turns into its finished product PHYSICAL CHANGES - Physical changes involve a change in state. Do you remember what the three - [Atoms, Subatomic, Bohr-Rutherford Model](https://schoolworkhelper.net/atoms-subatomic-bohr-rutherford-model/) - About 100 years ago, scientists came up with a term for the smallest piece of matter: the atom. The word atom comes from the Greek word “atomus” which means “indivisible.” - Since scientists didn’t have very good laboratory equipment over one hundred years ago, they were slightly mistaken about atoms. The atom is the smallest - [Chemical Symbols and Formulas](https://schoolworkhelper.net/chemical-symbols-and-formulas/) - - In 1817, Jakob Berzelius created an international system to represent all elements with symbols. - We still use his system today (all over the world), which involves elements being represented by one or two letters found in their name. The first letter is always capitalized. If there is a second letter, it is always - [Organize the Elements: Periodic Table](https://schoolworkhelper.net/organize-the-elements-periodic-table/) - In the mid-1800s there were 64 known elements (today there are over 116 elements). Scientists kept having difficulties organizing the information about the 64 elements. They kept trying to organize them but found no pattern between them. Many chemicals have very similar colors, luster, and conductivity of electricity and heat. Scientists were able to classify - [Electricity and Matter](https://schoolworkhelper.net/electricity-and-matter/) - Everything in the universe is either matter or energy. We studied matter in the Chemistry unit; it is everything that we can touch, smell, taste, and see. Energy is the ability to do work and it comes in many different forms. Forms of energy include kinetic energy (energy of movement), light, heat, solar energy (from - [The Electric Circuit: Series and Parallel Circuits](https://schoolworkhelper.net/the-electric-circuitseries-and-parallel-circuits/) - - All electrical devices have an electric circuit, also known as a path for electrons to flow. - All circuits have at least four parts: An energy source (we’ll be using batteries which are also called “cells”). An electric load (an electrical device used to convert electricity to another form of energy. We’ll be using - [Energy Conservation](https://schoolworkhelper.net/energy-conservation/) - - As the human population keeps increasing (it’s over 6 billion people right now), we keep requiring more and more energy. - Using too much energy places stress on our energy production systems and may cause blackouts when we need the energy the most. HOW DO WE USE ELECTRICITY? - In order to conserve (save) - [Electricity around the House](https://schoolworkhelper.net/electricity-around-the-house/) - - Your home is one large electric circuit that is wired in parallel (multiple electron paths) - Today we’re going to look at how electricity is delivered to your homes. HOW ELECTRICITY FLOWS TO YOU - Electricity flows to every home through high-voltage wires. The wires are either above ground and span over cities in - [Renewable and Non-renewable Energy Sources](https://schoolworkhelper.net/renewable-and-non-renewable-energy-sources/) - Humans are very reliant upon electricity. Think back to the blackout of August 2003 and recall how whole cities were shut down. Since we rely on electricity so much, it’s important to produce as much of it as possible and conserve it whenever we can. All energy sources are either renewable or nonrenewable. A renewable - [Three Aspects of Religion](https://schoolworkhelper.net/three-aspects-of-religion/) - Religion as Belief Belief in what? The truth and existence of God(s) and/or Goddess(es) Cosmic Order? Afterlife? "Something out there" Truth contained in religious texts, doctrines (beliefs), and/or ethics? Why do people believe? What convinces them of their belief? What does this sort of belief do for the believer? Religion as Rite (practice) Sacraments, prayer, - [First Nations Spirituality](https://schoolworkhelper.net/first-nations-spirituality/) - Origins -Archaeological evidence suggests humans came to North America approximately 14,000 years ago, across the Bering land bridge -Most First Nations creation stories suggest that people have simply always been here (e.g. The Haida people's Raven story, Iroquois people's turtle island story Beliefs -Many First Nations people practice Christianity – a reminder of the impact - [Confucianism Beliefs and Teachings](https://schoolworkhelper.net/confucianism-beliefs-and-teachings/) - Confucius was a contemporary of Lao Tzu, they had similar philosophies (e.g. the importance of harmony and balance)Confucius mastered the six arts: ritual, music, archery, charioteering, calligraphy, and arithmeticHis father died when he was a child, his mother died when Confucius was in his early 20's.After this, he became a teacher and built a reputation - [Jainism History and Beliefs](https://schoolworkhelper.net/jainism-history-and-beliefs/) - History Jains believe that their founder, Vardhamana Mahavira (599-527 BCE) is the last of 24 holy teachers who came to teach the way of self mastery. Mahavira is not looked at exactly as a religious founder, but rather as a teacher who came to re-establish what had previously been taught Mahavira was a jina or - [Zoroastrianism History and Beliefs](https://schoolworkhelper.net/zoroastrianism-history-and-beliefs/) - History · Their theology has had a great impact on Judaism, Christianity and other later religions, in the beliefs surrounding God and Satan, the soul, heaven and hell, saviour, resurrection, final judgment, etc. · It is one of the oldest religions still in existence, · It may have been the first monotheistic religion. · The - [Buddhist Practices and Rituals](https://schoolworkhelper.net/buddhist-practices-and-rituals/) - Most Buddhist devotions are not performed in a temple, instead people have a place of worship in their homes The temple is usually reserved for important celebrations Puja – showing reverence for holy beings by bowing, making offering and chanting (e.g. showing reverence for a Bodhisattva – a person who has attained Nirvana but chooses - [Schools of Buddhism](https://schoolworkhelper.net/schools-of-buddhism/) - School Geography Thoughts Rituals Theravada Sri Lanka, Thailand, Laos, Cambodia "the way of the elders" Conservative Do not worship Buddha as a god. Meditation Mahayana China, Vietnam, Korea, Japan "the greater vehicle" Older forms of the religion. Liberal Heavens are populated with Buddha or divinities to whom people can pray. Bodhisattvas. -the buddha is the - [Buddhism: The Four Noble Truths](https://schoolworkhelper.net/buddhism-the-four-noble-truths/) - The Buddha observed that no one is free from death and unhappiness (dukkha) Buddha looked for the source of that unhappiness (like a doctor looking for the source of an illness) These are the four noble truths, and they are central to understanding Buddhism Some people see great wisdom in these truths; others find them - [Buddhism: The Noble Eightfold Path](https://schoolworkhelper.net/buddhism-the-noble-eightfold-path/) - The Buddha chose the symbol of an eight-spoked wheel to represent the path to Nirvana The center of the wheel represents Nirvana, the only fixed point Just like the spokes are needed to let the wheel turn, Buddhists need to follow each step of the path to reach Nirvana Each path is used not individually, - [Judaism Origins](https://schoolworkhelper.net/judaism-origins/) - Smallest (about 14 million) of the major world's religions Why study it then? – Long history of persecution that we can learn from, and Judaism has made a huge contribution to Western philosophy and religious thinking. Oldest of the Abrahamic faiths, dating back about 4000 years Shares a history and mythology with Christianity and Islam - [What Do Jews Believe? Jewish Practices and Rituals](https://schoolworkhelper.net/what-do-jews-believe-jewish-practices-and-rituals/) - There is one God who is the creator of everything God is immaterial (without form) God governs the universe with honour and justice Therefore, humanity has an obligation to worship God Jewish Practices and Rituals The Synagogue: Place of worship and study Sometimes called "Shul" (Yiddish for school) The Torah Scroll: Holy book Most sacred - [Christian Beliefs: The Nicene Creed](https://schoolworkhelper.net/christian-beliefs-the-nicene-creed/) - Within a few generations of Jesus' death, Christianity had spread from the middle east to Greece and Rome325 CE, the Emperor of Rome organized a council of religious leaders at Nicea (a city in modern-day Turkey)The idea was to decide on the official beliefs of the Christian Church.This meeting produced the Nicene Creed, which outlines - [Christian Groups & Institutions](https://schoolworkhelper.net/christian-groups-institutions/) - The Great Schism 1054 It is often stated that the Eastern Orthodox Church and the Roman Catholic Church was founded at the time of this great schism. That is false. The One Holy Catholic and Apostolic Church was ruled by five patriarchs: those of Rome, Constantinople, Antioch, Alexandria, and Jerusalem, each having authority over bishops - [Christianity: Origins and Beliefs](https://schoolworkhelper.net/christianity-origins-and-beliefs/) - Origins Christianity began in the land of Palestine (Israel), primarily in Galilee and Judaea. Founded by Jesus of Nazareth (c. 4 BCE – c. 29 CE), who has left no writings of his own. Jesus began teaching and healing around the age of thirty. Jesus was born a Jew who prescribed changes within Judaism. Jesus - [Islamic Beliefs: Shahadah & Allah](https://schoolworkhelper.net/islamic-beliefs-shahadah-allah/) - Muslim belief can be summarized in a creed called the Shahadah: "There is no god but God and Muhammad is the messenger of God" This idea is central to Islam, and all other beliefs and traditions are based on it God God's proper name is Allah Allah is omnipresent (all-present), omniscient (all-knowing), and omnipotent (all-powerful) - [Islamic History and Origins](https://schoolworkhelper.net/islamic-history-and-origins/) - Islam shares a common history with Christianity and Judaism up until the time of Abraham. Muslims believe that the Prophet Muhammad is a descendant of Ishmael, the son that Abraham had with Hagar and then banished. Abraham, Moses, Jesus, and Muhammad are all considered to be prophets who attempted to reveal Allah's will to humankind. - [Islamic: Sacred Writings, Groups, Women](https://schoolworkhelper.net/islamic-sacred-writings-groups-women/) - The Qur'an -"Qur'an" means recitation -The revelations that Muhammad received through Gabriel are literally the Word of God -This distinguishes it from other sacred writings (e.g. the Torah, the Bible) -Even translations from Arabic are considered suspect -The Qur'an was revealed to Muhammad over a period of 23 years -He remembered them and taught his - [Art, Artists, Architecture and Music during the Renaissance](https://schoolworkhelper.net/art-artists-architecture-and-music-during-the-renaissance/) - Art Paintings showed nature and peoples feelings Artists studied perspective and used types of form, color, and shape Paintings became more realistic and less religious Artists – Leonardo Da Vinci: Born in 1452 in the village of Vinci The most famous works are The Mona Lisa and The Last Supper Died in 1519 Michelangelo Buonarroti: - [Holidays, Festivals and Celebrations in the Elizabethan Era](https://schoolworkhelper.net/holidays-festivals-and-celebrations-in-the-elizabethan-era/) - January-Twelfth Night Celebrated evening of January 5 Celebrates the end of Christmas February-Valentines Day February 14th was the day of Valentines Day. Celebrates love. March – Easter Easter was suppose to resemble religious mysteries and the humans urges we have towards light and warmth April- All Fool’s Day Celebrated April 1 Everything is backwards on - [Acid Rain: How is it made? What are its effects?](https://schoolworkhelper.net/acid-rain-how-is-it-made-what-are-its-effects/) - Introduction Acidic pollutants can be deposited from the atmosphere to the Earth's surface in wet and dry forms. The common term to describe this process is acid deposition. The term acid precipitation is used to specifically describe wet forms of acid pollution that can be found in rain, sleet, snow, fog, and cloud vapor. An - [What is Adaptation? Types of Adaptations](https://schoolworkhelper.net/what-is-adaptation-types-of-adaptations/) - Change in an organism's physical structure or behavior that improves its ability to survive in its habitatAnything that helps an organism survives in its environment is an adaptationAdaptation also refers to organisms’ ability to adjust to various conditions within their environmentExamples: change in the size of bird's beak, development of sharp teeth and claws, etc. - [Evolution: Genetic Drift, Gene Flow, Mutations, Random Change](https://schoolworkhelper.net/evolution-genetic-drift-gene-flow-mutations-random-change/) - Random change Key factors that can cause evolution:-Small populations are more variable to changes in allele frequencies-non-random mating opportunities result in only those “preferred” traits being passed onto future populations-new alleles may be created when mutations occur (changes the frequencies of new and original alleles)-migration causes changes in the relative abundance of alleles-natural selection takes - [Consequences of Burning Fossil Fuels](https://schoolworkhelper.net/consequences-of-burning-fossil-fuels/) - #1 Climate Change The increase in greenhouse gasses (mainly CO2, CH4, and NOs) due to the burning of fossil fuels is causing a general increase in the average global surface temperatureMore greenhouse gasses are causing more of the sun’s and earth’s radiation to be trapped in our atmosphereSome areas are expected to experience an increase - [Plant Growth, History, Classification, Factors](https://schoolworkhelper.net/plant-growth-history-classification-factors/) - Plant History Canada has at least 5000 different plant species. These range from flowering plants, to large trees, to agricultural plants The earliest plant is believed to have evolved 430 million years ago The first land plants were mosses and ferns All land plant life can be traced back to those species. Classification of Plants: - [Air Pollution: Aerosol, Gaseous](https://schoolworkhelper.net/air-pollution-aerosol-gaseous/) - The Air We Breathe Clean dry air is a mixture of 4 main gasses: 78.08% is Nitrogen 20.95% is Oxygen 0.934 is Argon 0.035% is Carbon Dioxide Water vapour, Neon, Helium, Methane, Krypton, Hydrogen, Carbon Monoxide, Xenon, Ozone, Nitrogen Oxides, Sulfur Oxides and Hydrogen Sulfide are found in trace amounts Air Pollution An imbalance in - [Types of Waste](https://schoolworkhelper.net/types-of-waste/) - There are many different types of Waste Solid Waste Liquid Waste Gaseous Waste Animal by-products Biodegradable waste Biomedical waste Chemical waste Commercial waste Construction and demolition waste (C&D waste) Electronic waste (E-waste) Green waste Grey water Hazardous waste or Toxic Waste Human waste Industrial waste Radioactive waste Recyclable waste Sewage Slaughterhouse waste Wastewater Industrial Waste - [Greenhouse Effect](https://schoolworkhelper.net/greenhouse-effect/) - Goldilocks Principle Venus is too hot, Mars is too cold but Earth is just right Earth's average temperature sits between the boiling and freezing temperatures of water. This makes it ideal for life Insulating gas blanket Earth's "perfect" surface temperature for life is often thought to be because of it's orbit distance from the Sun. - [Energy Efficiency: Conducting a Simple Energy Audit](https://schoolworkhelper.net/energy-efficiency-conducting-a-simple-energy-audit/) - Efficiency Energy efficiency is one area that scientists are focusing on to decrease the worlds overall energy use Energy efficiency in buildings is one of the top priorities in energy conservation There are many different ways that we can make an older building more energy efficient Simple ways to improve a building's efficiency Insulate and - [Perspectives in Environmental Science](https://schoolworkhelper.net/perspectives-in-environmental-science/) - The basics Environmental issues are particularly difficult to solve because often the solutions require sacrifice It is difficult to convince a population of people to trade in quality of life and convenience for the greater environmental good This is evident with North America’s obsession with big cars, SUVs and Trucks When considering an environmental issue - [Agricultural Practices: Farming, Pesticides, Terminology](https://schoolworkhelper.net/agricultural-practices-farming-pesticides-terminology/) - What is Agriculture? Agriculture is the production of food and goods through farming and forestry.The development of agricultural techniques is credited for creating food surpluses that enabled the development of more densely populated societies with distinct classesAgriculture uses many techniques, to expand the lands suitable for plant raising.For example: Digging water-channels and other forms of - [Energy Use, Types, Sources](https://schoolworkhelper.net/energy-use-types-sources/) - Energy Types Energy sources are classified as either renewable or non-renewable A renewable energy resource is one that can be replaced after use by regrowth, reproduction or replacement within a reasonable time frame (usually one human lifespan). Examples include solar, wind, tidal, thermal and hydroelectric A non-renewable resource is one that cannot be replaced after - [Exposure and Uptake of Environmental Contaminants](https://schoolworkhelper.net/exposure-and-uptake-of-environmental-contaminants/) - Humans come into contact with harmful contaminants in many ways. We may: eat food that carries toxin residues touch contaminated soils absorb radiation or chemical vapors through our skin drink polluted water inhale gases and particulates as we breathe Determining how much exposure of a contaminant is safe is a multi step process that involves - [Environmental Contaminants: Heavy Metals, Synthetic Organic Contaminants, Volatile Organic Compounds](https://schoolworkhelper.net/environmental-contaminants-heavy-metals-synthetic-organic-contaminants-volatile-organic-compounds/) - What is an Environmental Contaminant? Environmental contaminants are substances that, when accidentally or deliberately introduced into the environment, may have the potential to harm people, wildlife and plants. Some of these contaminants may have been manufactured for industrial use and because they are very stable, they do not break down easily. If released to the - [Factors to Consider when Choosing and Environmental Resource](https://schoolworkhelper.net/factors-to-consider-when-choosing-and-environmental-resource/) - Cost Is this a cheap energy resource to use? Are the start up costs minimal or large? Are the operation costs minimal or large? Does there need to be more research? Availability and Accessibility Availability Is this energy resource one we can harness now? Is it in the research process? Is there lots of supply - [The Story of Oedipus](https://schoolworkhelper.net/the-story-of-oedipus/) - We don't know whether there was a historical Oedipus. "Oedipus" means "swollen feet". The Greeks pronounced it "oy-DEEP-us". Oed- is the same root as "oedema / edema" (tissue swelling; the British preserve the initial "o"), while "-pus" is feet (hence "octopus", the eight-footed animal.) Laius and Jocasta were king and queen of Thebes, a town - [Aristotle on Tragedy](https://schoolworkhelper.net/aristotle-on-tragedy/) - Since the days of ancient Greece, tragedy has been regarded as the highest form of literary art. But what is tragedy? Many definitions have been offered, but the most influential is the one presented by the philosopher Aristotle in his work entitled Poetics. Having read Oedipus the King, to which Aristotle frequently refers, you might - [Karl Marx: Theories, Research, Biography](https://schoolworkhelper.net/karl-marx-theories-research-biography/) - Karl Marx was an economist, revolutionary and a sociologist, amongst other occupations. Moving around Germany, France and finally England, he developed his theories and ideas that would lead him to attempt a revolution to overthrow the capitalist system. Despite being close to starting one such revolution, it quickly dissipated when it lost support. He wrote - [Howard Gardner: Biography & Multiple Intelligence](https://schoolworkhelper.net/howard-gardner-biography-multiple-intelligence/) - Dr. Howard Gardner is a professor of education at Harvard University, he is also a psychologist. In 1983 Gardner developed the theory of multiple intelligences. It suggested that the original notion of intelligence based on an I.Q. test was far too limited. Gardner came up with 8 different intelligences to account for the broader range - [Jean Piegat: Biography & Theory of Cognitive Development](https://schoolworkhelper.net/jean-piegat-biography-theory-of-cognitive-development/) - Developed a theory about childhood development that still greatly influences behavioural psychologist and educators today. Biography: -born in 1896-1980 in Neuchatel -attended the University of Neuchatel -received a PhD in Natural Science -Moved to Paris, France to teach at an all boy school -Here was what led him to his theory that young children’s cognitive - [B.F. Skinner: Biography, Theories, Contributions](https://schoolworkhelper.net/b-f-skinner-biography-theories-contributions/) - Burrhus Frederic SkinnerBorn March 20, 1904Died August 18, 1990Received his BA in English and attempted to be a writerWent back to school at Harvard and received his masters in psychology in 1930 and then his doctorate in 1931One of the best psychology writers: Walden II, Behaviour of Organisms, Science Human BehaviourBehaviourist psychologist who was involved - [What is Active Listening?](https://schoolworkhelper.net/what-is-active-listening/) - Active Listening is a way of listening and responding to another person that improves mutual understanding. Active listening is a structured form of listening and responding that focuses the attention on the speaker. Active listening is an important way to bring about changes in people. Despite the popular notion that listening is a passive approach, - [What is Peer Pressure?](https://schoolworkhelper.net/what-is-peer-pressure/) - Peer Pressure: = the pressure that you feel to do what others your age (individuals or groups) are doing. An example of POSITIVE peer pressure: = role models (e.g. people who get good grades, have good study habits, volunteer in the community) An example of NEGATIVE peer pressure: = gangs (e.g. groups that may be - [Eldridge v. British Columbia (Attorney General) (SCC, 1987)](https://schoolworkhelper.net/eldridge-v-british-columbia-attorney-general-scc-1987/) - Summary of Facts: Hospital Insurance Act and the Medical and Health Care Services Act. Neither program provides funding for sign language interpretation for the deaf. All of the appellants were born deaf and use sign language as their preferred means of communication. The appellants claim that without the use of an interpreter, they are unable - [Ontario Human Rights Code](https://schoolworkhelper.net/ontario-human-rights-code/) - Overrules all other Ontario legislation unless that legislation states that the Human Rights Code does not apply Provides civil remedies, not criminal penalties People found to have engaged in discrimination can be ordered to compensate an individual or make changes to the way they conduct their affairs. Scope of the Code – What does the - [The Abolitionist Movement](https://schoolworkhelper.net/the-abolitionist-movement/) - Why Abolitionism? Abolitionism was a movement to end the slave trade and to emancipate (free) slaves in both Western Europe and the Americas. It usually took part in Northern states (but not everyone was anti-slavery), than in Southern states. The Enlightenment and the Great Awakening are what stirred things up and made some begin to - [Development of Political Parties](https://schoolworkhelper.net/development-of-political-parties/) - Early America believed that organizing a political party was corrupt or subversive Parties would fill Congress with men of little ability who put special interests over national welfare George Washington tried to have an impartial presidency by consulting members of both camps By 1794, split into two parties: Federalists who controlled the executive, and the - [The Progressive Era](https://schoolworkhelper.net/the-progressive-era/) - Definition: Period from 1900 – 1920 during which reformers sought to improve government, regulate businesses, help workers and help the poor. Theodore Roosevelt (Republican) VP for William McKinley, became president at age 43 when McKinley assassinated in 1901- youngest ever Wanted to give all Americans a ‘Square Deal’- a more just and equitable society Much - [The Second Red Scare](https://schoolworkhelper.net/the-second-red-scare/) - With onset of Cold War in late 1940s began 2nd Red Scare. This included: House of Un-American Activities Committee (HUAC) was est. in WW2 to investigate ‘unpatriotic behavior’- late 1940s devoted to catching Communists -Highest profile investigation into Hollywood motion picture industry- produced a list called ‘The Red Channels’ identifying suspected Commies in Hollywood High - [End of the Cold War Summary](https://schoolworkhelper.net/end-of-the-cold-war-summary/) - In 1989, the Cold War was declared officially over at a meeting between the U.S.A. and U.S.S.R.- Who Won? "The end of the Cold War is our common victory"- Mikhail Gorbachev "Ronald Reagan had a higher claim than any other leader to have won the Cold War for liberty and he did it without a - [The Death of Shakespeare](https://schoolworkhelper.net/the-death-of-shakespeare/) - Shakespeare died in 1616 on his birthday, which was April 23, at Stratford-upon-Avon, which is in England. He died when he was 52. We have two different sources. The first one says his cause of death was unknown. The second one says he died after drinking with his theater friends. He was buried at the - [Shakespeare Biography: Actor & Playwright](https://schoolworkhelper.net/shakespeare-biography-actor-playwright/) - We know very little about Shakespeare's life during two major spans of time, commonly referred to as the "lost years." The lost years fall into two periods: 1578-82 and 1585-92. The first period covers the time after Shakespeare left grammar school until his marriage to Anne Hathaway in November of 1582. The second period covers - [A Working Definition of Family](https://schoolworkhelper.net/a-working-definition-of-family/) - Currently popular are definitions of family based on what they do rather than who comprises them. These definitions reflect a desire to include groups that do not fit the traditional man-woman-child model. These definitions are most suited to the study of the interrelationships of individuals and families in this course. The Vanier Institute of the - [The Different Units or Branches of Philosophy](https://schoolworkhelper.net/the-different-units-or-branches-of-philosophy/) - Metaphysics Studies the nature of being; the makeup, working and organization of reality in general. Often looks at aspects of being that cannot be observed and measured, such as God and virtue Basic questions include: What is being? What are its fundamental features and properties? Logic & the Philosophy of Science Logic deals with the - [Socrates, Plato and Aristotle](https://schoolworkhelper.net/socrates-plato-and-aristotle/) - Socrates 470-399 B.C,- NEVER wrote anything Gave philosophy its preeminent method- Socratic method or questioning (form of inquiry and debate between individuals with opposing viewpoints based on asking and answering questions to stimulate rational thinking and to illuminate ideas) Believed knowledge does not come from memorizing facts & repeating them True wisdom comes from being - [Thomas Kuhn: Science and Progress](https://schoolworkhelper.net/thomas-kuhn-science-and-progress/) - He does not believe that science proceeds from one advancement to another, in an even and unbroken process. Kuhn’s view is that scientists work within an unquestioned theory or set of beliefs: Mental Paradigm This mental paradigm (accepted view) shapes scientists’ thinking as they work. Within this set of beliefs, scientists search for information and - [The Three Major Forms of Inductive Reasoning](https://schoolworkhelper.net/the-three-major-forms-of-inductive-reasoning/) - Inductive Generalization uses specific examples to draw general conclusions. People use inductive generalizations to observe situational patterns which they project on new cases. What pattern do you see in the following premises? Premise: In the 1950s, one out of five households in North Bay had a television set. Premise: In the 1970s, four out of - [What is Critical Thinking?](https://schoolworkhelper.net/what-is-critical-thinking/) - Critical thinking -involves two major tasks: judging the value of information and judging the strength of arguments. We decide what to believe or do based on making such judgments. Relevance Determining whether the information or arguments presented have any bearing on the matters at hand Irrelevant information or argument should be rejected. Examples: A charge - [Philosophy of Science!](https://schoolworkhelper.net/philosophy-of-science/) - We examine the ideas developed by scientific philosophers, and the questions they asked, including: What are the characteristics of a good scientific method? How do we know if knowledge is supported by data? What is a "cause"? What role does observation and reason play in science and in everyday life? Is science purely rational and - [Karl Popper: Science and Falsifiability](https://schoolworkhelper.net/karl-popper-science-and-falsifiability/) - He argued that it is only through the free investigation and testing of ideas that knowledge can be moved forward. He believed that it is not generally possible to prove the truth of any theory or idea with certainty. We can have only probable knowledge, and search for evidence with examples that support our views. - [Sextus Empiricus and Total Skepticism](https://schoolworkhelper.net/sextus-empiricus-and-total-skepticism/) - In the Hellenistic and Roman periods after Plato, there were two kinds of Skeptics, and they were something like rivals: the Academics and the Pyrrhonists (stemming from Pyrrho of Elis, c. 360 – 270 B.C.). Sextus Empiricus was the last great Pyrrhonist. The Academics, according to Sextus, maintained that “all things are inapprehensible,” whereas the - [The Radical Empiricism of David Hume](https://schoolworkhelper.net/the-radical-empiricism-of-david-hume/) - Born in Scotland (1711-1776) Adopted and refined some of Locke's theories In addition to philosophy, was a historian and essayist Some call him "the most important philosopher ever to write in English" Hume's Answer to the Quarter Experiment: When you are observing something, like a quarter, for instance, you are not observing the quarter but - [Modern Theories of Truth: Correspondence Theory, Coherence Theory, Pragmatism](https://schoolworkhelper.net/modern-theories-of-truth-correspondence-theory-coherence-theory-pragmatism/) - Correspondence Theory Best known, most widely used conception of truthMaintains there is a relationship (correspondence) between people’s internal beliefs and realities in the external world (truth means agreement between thought and reality)Belief is true if it agrees with fact or coincides with the physical world or objective realityTruth claims should be checked against measurable facts - [Ethical Relativism: Ethics that Depend on Culture](https://schoolworkhelper.net/ethical-relativism-ethics-that-depend-on-culture/) - Ethical Relativism: there are no common, universal, or objective values. Moral values are developed by individual peoples, groups, or cultures to fit their unique conditions. Relativists say that all moral rules are equally acceptable, because there is no way of judging between them. They do believe in moral right and wrong, but they do not - [Friedrich Nietzsche: Beyond Good and Evil](https://schoolworkhelper.net/friedrich-nietzsche-beyond-good-and-evil/) - Nietzsche attacked traditional ethical theories, especially those rooted in religion. He rejected the view that people are ultimately accountable only to God. He did so because he believed that human life had no moral purpose except for the meaning that human beings gave it. Nietzsche was extremely critical of most traditional ethics. He called Utilitarianism - [Existentialism & Jean-Paul Sartre: Sartre and Kant on Ethics](https://schoolworkhelper.net/existentialism-jean-paul-sartre-sartre-and-kant-on-ethics/) - Existentialism: a philosophical movement that focuses on individual autonomy and the necessity of making reasoned decisions for oneself. Jean-Paul Sartre, (1905-1980) French author and philosopherBest-known proponent of humanistic existentialismA Marxist advocate of political causesFrench resistance fighter of WWIIWinner of the Nobel Prize for literature Sartre was an atheist who believed that human beings had no - [Definitions of Philosophy](https://schoolworkhelper.net/definitions-of-philosophy/) - Philosophy is... ...Seeking after wisdom or knowledge, esp. that which deals with ultimate reality, or with the most general causes or principles of things and ideas and human perception and knowledge of them, physical phenomena (natural philosophy) and ethics (moral philosophy)- Concise Oxford Dictionary ...An activity- the attempt to understand the general principles and ideas - [Different Conceptions of Justice](https://schoolworkhelper.net/different-conceptions-of-justice/) - Justice as Retribution Retributive justice is based on belief those who break the law should be punished severely Many who believe in this also believe that the punishment should fit the crime- long standing biblical principle: And he that killeth any man shall surely be put to death... And if a man cause a blemish - [On the Duty of Civil Disobedience (1849): Henry David Thoreau](https://schoolworkhelper.net/on-the-duty-of-civil-disobedience-1849-henry-david-thoreau/) - Thoreau (1817-1862) was an American naturalist and writer. This work of his has become the basis of non-violent protest throughout history and the world. Thoreau believed that nonviolence or passive disobedience was necessary whenever government edict conflicted with higher moral law- the ideal natural law, from which human law was derived. I heartily accept the - [Martin Luther King's Letter from the Birmingham Jail (1963)](https://schoolworkhelper.net/martin-luther-kings-letter-from-the-birmingham-jail-1963/) - [B]asically, I am in Birmingham because injustice is here.... Injustice anywhere is a threat to justice everywhere. We are caught in an inescapable network of mutuality, tied in a single garment of destiny. Whatever affects one directly, affects all indirectly. Never again can we afford to live with the narrow, provincial "outside agitator" idea.... You - [Plato and Politics: Why we form a political society?](https://schoolworkhelper.net/plato-and-politics-why-we-form-a-political-society/) - Ideas laid out in The Republic (380 BCE) Individual human beings are not self-sufficient- can’t acquire all necessities of life working alone Thus, form communities in which we work for common goals Goals better achieved if each person specializes in a specific role (farmer, carpenter, merchant etc.)- Each person should ONLY perform task for which - [What is Conservatism?](https://schoolworkhelper.net/what-is-conservatism/) - Conservatism is a preference for the historically inherited rather than the abstract and ideal. Believes society should be rooted in long-standing traditions and its institutions should reflect those traditions Why conservatives believe this: Movement began as a response to the French Revolution (1789)- people of France replaced monarchy with new forms of gov't, resulting in - [The Communist Manifesto (1848): Karl Marx & Friedrich Engels](https://schoolworkhelper.net/the-communist-manifesto-1848-karl-marx-friedrich-engels/) - The history of all hitherto existing society is the history of class struggles. Freeman and slave, patrician and plebeian, lord and serf, guild master and journeyman, in a word, oppressor and oppressed, stood in constant opposition to one another, carried on...a fight that each time ended either in a revolutionary reconstruction of society at large - [Herbert Marcuse: One-Dimensional Man](https://schoolworkhelper.net/herbert-marcuse-one-dimensional-man/) - Herbert Marcuse (1898-1979) Socialist philosopher and German-Jew that fled World War II Germany and immigrated to the USA Wrote One-Dimensional Man to explain why widespread communist revolution had not happened One-Dimensional Man (1964) Capitalism uses advertising, consumerism, mass media, entertainment industry as a means of social control- produces conformity in what people desire, think Created - [Types of Documentaries](https://schoolworkhelper.net/types-of-documentaries/) - TRADITIONAL DOCUMENTARY Covers a person or event from the past. It uses only voiceover narration and a combination of archival media and created media (still images and video). It does not use interviews. TRADITIONAL DOCUMENTARIES WITH INTERVIEWS As above but with the addition of interviews to document the topic. CINEMA VERITE Covers present day events - [Plate Tectonics & Continental Drift Proof](https://schoolworkhelper.net/plate-tectonics-continental-drift-proof/) - Definition: Continental Drift It is the theory that the earth’s continents are constantly in motion and at one time they all collided together to form one massive continent about 300 million years ago! Pangaea (meaning “all lands”) began to break up and drift apart. Founder of the Continental Drift Theory Alfred Wegener came up with - [Rocks and the Rock Cycle](https://schoolworkhelper.net/rocks-and-the-rock-cycle/) - Layers of rocks can be faulted, folded and tilted by large forces within the Earth's crust. The study of these changes can give information about the strength and direction of the forces involved. Sedimentary rocks - layers of rock fragments that were compressed and cemented together. They often contain fossils. Igneous rocks - molten rock - [Soil and Vegetations: Parts, Functions, Threats](https://schoolworkhelper.net/soil-and-vegetations-parts-functions-threats/) - FOUR MAIN PARTS TO SOIL 1. Minerals – comes from the weathering (chemical, physical) of the parent material. The inorganic material in soil is made up of rock material mainly. It can be sand, silt or clay. The particles in each of these rock types are ordered from larger to smaller with sand being the - [Rural Settlement Patterns](https://schoolworkhelper.net/rural-settlement-patterns/) - Population distribution - the pattern of where people live in a region, or across the country. There are 2 main patterns, dispersed and concentrated Two main catgories of settlement in Canada. Rural ,and Urban Rural – outside of cities and towns, low population density, dispersed settlement pattern Three factors affect pattern of rural settlement 1. - [Early Cod Fishing](https://schoolworkhelper.net/early-cod-fishing/) - The Norse had explored and wintered in North America some 500 years before Giovanni Caboto, a Genoese explorer whom the British called John Cabot, rediscovered the land in 1497. Although Cabot failed to find a northern route to the rich spice trade in Asia, he returned with tales of an ocean teeming with cod and - [Urban Land Use](https://schoolworkhelper.net/urban-land-use/) - 80 % of Canadians live in cities cities are broken up into 6 major land-use groups – residential, transportation, institutional and public buildings, open space and recreational land, industrial, and commercial Residential Land Use Where people live includes low (houses), medium (town houses) and high density (apartment buildings) Takes up 40% of land in cities - [Types of Industry](https://schoolworkhelper.net/types-of-industry/) - There are four major types of industry in Canada/USA/Europe. Primary, Secondary, Tertiary and Quaternary. Primary Industries Industries that take in raw materials from the natural environment. Also known as extractive industries. (known as primary because extraction or removal of natural resources must happen before anything else can be made. Everything comes from the earth) Primary - [Voltage](https://schoolworkhelper.net/voltage/) - Energy can be defined as the ability to do work. Electrons possess energy and this energy can be converted to another form to do work (make a lightbulb shine, motor run, etc). This energy is called electric potential energy. Definitions: Electric potential energy: energy that the battery gives to the electrons; the amount of energy - [What is Electrical Resistance?](https://schoolworkhelper.net/what-is-electrical-resistance/) - A material that lets electrons flow through it is called a CONDUCTOR The molecules of all types of conductors resist the flow of electrons to some degree ELECTRICAL RESISTANCE is a measure of how easy or hard it is for electric current to move through a material Conductors have low resistance Insulators have high resistance - [Models of celestial motion: Geocentric & Heliocentric](https://schoolworkhelper.net/models-of-celestial-motion-geocentric-heliocentric/) - Geocentric view: Earth-centered view. (600BC – 150 AD) Came from the belief that God created humans at center and everything moved in perfect divine circles. Earth was a sphere that remained motionless at center of the universe Sun, Moon, Mercury, Venus, Mars, Jupiter and Saturn orbited earth in circles Stars traveled around the earth on - [What is light? Sources of Light](https://schoolworkhelper.net/what-is-light-sources-of-light/) - What is light? A form of energy that the Sun emits in all directions Properties of Light Light travels in straight lines: Light travels VERY FAST – around 300,000, 000 metres per second. (3.0 x 108 m/s) Light travels much faster than sound. For example: Light energy is transferred through radiation RADIATION A method of - [Our Planet: The Four Spheres](https://schoolworkhelper.net/our-planet-the-four-spheres/) - THE LITHOSPHERE The part of the earth that is made up of rocks and minerals, consists of the uppermost layers of the earth Came into being billions of years ago and still continues to change and evolve Changes to the worlds land masses, tectonic plates Volcanoes, earthquakes THE HYDROSPHERE The part of the earth made - [THE SPHERES OF THE EARTH](https://schoolworkhelper.net/the-spheres-of-the-earth/) - The earth consists of air, water, and land. We recognize these more technically as the atmosphere, a gaseous envelope surrounding the earth; the hydrosphere, the waters filling the depressions and covering almost 71 percent of the earth; and the lithosphere, the solid part of the earth which underlies the atmosphere and hydrosphere. The Atmosphere. The - [THE ORIGIN AND AGE OF THE EARTH](https://schoolworkhelper.net/the-origin-and-age-of-the-earth/) - The earth is but one of nine planets which make up our solar system. But to humans Earth is by far the most important of all planets, for it is our home. It is also, so far as we know, the only planet which supports any type of life. Whence came the earth? How and - [THE PLANET EARTH](https://schoolworkhelper.net/the-planet-earth/) - The earth, its relation to the stars and planets, and speculations as to its origin attracted human curiosity long before the birth of the geological sciences. Although such studies fall more properly within the realm of astronomy,' a brief survey of the earth and its planetary relations will provide the reader with some understanding of - [Macbeth: Summary, Analysis, Characters, Symbols](https://schoolworkhelper.net/macbeth-summary-analysis-characters-symbols/) - Written by William Shakespeare in 1605 Macbeth is a man who overthrows the rightful King of Scotland Shakespeare wrote Macbeth at the beginning of King James I reign Before James succeeded Elizabeth I he was king of Scotland Placing the play in James’ homeland probably pleased him Will the real Macbeth please stand up? Macbeth - [Writing about Literature](https://schoolworkhelper.net/writing-about-literature/) - A literary essay analyzes literature A literary essay must be primarily analytical It doesn’t just say what happened (this is simply plot summary and belongs in a book report, not an essay) It doesn’t just say what the theme is but explains how the writer conveys the theme It doesn’t just give examples of something - [The Elements of Fiction](https://schoolworkhelper.net/the-elements-of-fiction/) - The Elements Include: PlotSymbolismCharacterThemeSettingIronyPoint of ViewTone and Style PLOT An author’s selection and arrangement of incidents in a story shape the action and give the story a particular focus.Discussions of the plot include not just what happens, but also how and why things happen the way they do. The plot may have three parts:Rising ActionClimaxFalling - [Poetry: Terminology & Devices](https://schoolworkhelper.net/poetry-terminology-devices/) - POETRY A type of literature that expresses ideas, feelings, or tells a story in a specific form (usually using lines and stanzas) POET The poet is the author of the poem. SPEAKER The speaker of the poem is the “narrator” of the poem. POETRY FORM FORM - the appearance of the words on the page - [Economic Changes during Industrial Revolution](https://schoolworkhelper.net/economic-changes-during-industrial-revolution/) - During the Industrial Revolution there were dramatic changes in the social and economic structure. From a stable agricultural to a modern industrial society. - [Political Change during the Industrial Revolution](https://schoolworkhelper.net/political-change-during-the-industrial-revolution/) - The introduction of liberalism in the 18th century meant a new age in British politics, which continued through the Industrial RevolutionGladstone (Liberal) and Disraeli (Conservative) were two of the most influential political leaders of the late Industrial RevolutionBoth advocated reform of social structure; as a result, some of the more productive governments came to power. - [Social Changes During The Industrial Revolution](https://schoolworkhelper.net/social-changes-during-industrial-revolution/) - The social changes brought about by the Industrial Revolution were significantThe Industrial Revolution brought with it an increase in population and urbanization, as well as new social classes The poor living conditions in the towns can be traced to: Lack of good brick, the absence of building codes, and the lack of machinery for public - [Nations in Upheaval: Europe: 1850-1914 (France, Germany, Britain)](https://schoolworkhelper.net/nations-in-upheaval-europe-1850-1914-france-germany-britain/) - The Rise of the Nation-State Political leaders driven to consolidate power By 1871 the process of consolidation and unification had created modern Germany and Italy, altering the balance of power The struggle between states for land and wealth occurred primarily outside Europe through imperialism The process of expanding a nation’s territory through the acquisition of - [Imperialism, Colonialism, and Resistance in the Nineteenth Century](https://schoolworkhelper.net/imperialism-colonialism-and-resistance-in-the-nineteenth-century/) - Imperialism In The Nineteenth Century A significant shift occurred in the second half of the nineteenth century.After 1870 and even more dramatically after 1885, there was a remarkable increase in the European acquisition of colonial territories in the South Pacific, Asia, and AfricaIn 1870, about 10% of Africa had been colonized, whereas by 1895 approximately - [Russian Revolution](https://schoolworkhelper.net/russian-revolution/) - Pre-Revolutionary Russia Up until 1905, Czar Nicolas II had managed to contain the forces of change The failure of Russia in the Russo-Japanese war increased the general desire for reform Bloody Saturday in 1905 only led to more protests in both the cities and the countryside With the army tied up fighting the Japanese, the - [Stages of Learning](https://schoolworkhelper.net/stages-of-learning/) - VERBAL-COGNITIVE STAGE The task is completely new to the learner First problem: verbal and cognitive -identify the goal -evaluate performance -look at the what, when, and how of the skill -figure out what to do and generate an attempt -self talk: demands a lot of attention which prevents processing of simultaneous activities What can help - [Motor Learning and Skill Acquistion](https://schoolworkhelper.net/motor-learning-and-skill-acquistion/) - For human beings, the more we perform almost any skill, the better we become at it. In addition, as we physically grow and develop, our ability to master increasingly complicated skills is enhanced. Motor Learning the process by which a person develops, through a combination of physical and psychological factors, the ability to perform a - [How Women Athletes are Different from Men Athletes](https://schoolworkhelper.net/how-women-athletes-are-different-from-men-athletes/) - Up until the age of 12 to 14 (approximately the stage of puberty) boys and girls do not differ significantly in height, weight, girth, bone width, or skinfold thickness. PHYSIOLOGICAL RESPONSE TO ACUTE EXERCISE Neuromuscular responses Females: 40-60% weaker in the upper body 25-30% weaker in the lower body 5-15% weaker in lower body strength - [What is Physiology? Exercise physiology & Sports physiology](https://schoolworkhelper.net/what-is-physiology-exercise-physiology-sports-physiology/) - The study of the mechanisms by which the body functions Anatomy was the forerunner of physiologyStudy how our organ systems, tissues, cells, and molecules within cells work and how their functions are integrated to regulate our internal environments Exercise physiology The study of how our bodies' structures and functions are altered when we are exposed - [Basic Training Principles](https://schoolworkhelper.net/basic-training-principles/) - THE PRINCIPLE OF INDIVIDUALITY (aka INDIVIDUAL DIFFERENCES) Any training program must take into account the specific needs and abilities of the individuals for whom it is designed -we are not created equal with respect to adapting to exercise training -heredity plays a major role; except for identical twins, no 2 people have the same genetic - [Nutrition Recommendations for Canadians](https://schoolworkhelper.net/nutrition-recommendations-for-canadians/) - NUTRITION The study of the nutrients in foods and of the body’s handling of them. This includes ingestion, digestion, absorption, transport, metabolism, interaction, storage, and excretion. FOOD Material containing nutrients taken into the body for the maintenance of life and the growth and repair of tissues. NUTRIENTS Substances obtained from food and used in the - [Developing a Cardio-respiratory Endurance Program](https://schoolworkhelper.net/developing-a-cardio-respiratory-endurance-program/) - SOME MAJOR BENEFITS A larger, stronger, and more efficient heart muscle Decrease in your resting heart rate Increase in your VO2max Healthier blood vessels Increase in the number of capillaries in muscle and lungs Increase in blood volume and red blood cell (RBC) count Decrease in low density lipoprotein (LDL) and increase in high density - [How to Use a Light Microscope](https://schoolworkhelper.net/how-to-use-a-light-microscope/) - Always start on low power with a clean slide. The stage of the microscopes should be down as low as possible.Centre the slide so the specimen is underneath the objective lens.Use the Coarse adjustment knob to obtain a general focus. You will be slowly raising the stage until a focus is achieved.Use the fine adjustment - [Kingdom Archaea](https://schoolworkhelper.net/kingdom-archaea/) - Organisms in Archaea live in extreme conditions, such as: Very hot (hot springs, volcanoes, sea floor vents) Very cold Acidic Alkaline Salty High pressure All Archaea are prokaryotic and live in anaerobic conditions (no oxygen) … they obtain the energy they require from inorganic molecules or from light. Originally, organisms from the Archaea were classified - [Kingdom Bacteria](https://schoolworkhelper.net/kingdom-bacteria/) - Bacteria are prokaryotic and unicellular (although some join together to form colonies or link up in chains). When people think of bacteria, they immediately think of diseases – but disease-causing bacteria only make up a small fraction of all bacteria. Bacteria play an important role in ecosystems (decomposers, nitrogen fixation), and in edible products (cheese, - [Protists Characteristics](https://schoolworkhelper.net/protists-characteristics/) - of Protists: Eukaryotic Most unicellular, some multicellular Some have a cell wall, some do not Some are motile, some are not Some have pigments, some do not Many different feeding methods (phototrophic, heterotrophic, etc.) Most aerobic No complex sex organs – no embryos Lack specialized features of fungi, animals and plants Classifying Protists: Three groups, - [Ionization Energy](https://schoolworkhelper.net/ionization-energy/) - IE is related to the energy required to remove an electron from an atom. If an element has more than one electron to be removed, it will have more than one ionization Energy (IE) The first ionization energy is defined as the energy required to remove the outer most electron from a neutral atom in - [Half-Life: Radioactive Elements Decay Over Time](https://schoolworkhelper.net/half-life-radioactive-elements-decay-over-time/) - Radioactive elements have a half-life. Half-life occurs naturally in some of the radioactive elements while it could be artificially stimulated in some other elements. The half life of any given element is the time that is required for one half of the sample to decay. For example: If you have 10 grams of a radioactive - [What was Europe like in 1500?](https://schoolworkhelper.net/what-was-europe-like-in-1500/) - Europe was just beginning to emerge from the medieval period. Historians define the medieval period from 410 CE (the fall of Rome) to the beginning of the Renaissance (c.1450 CE) POLITICS Western Europe was a myriad of small states. Ancient Roman laws were mixed with local practices. Most states were ruled by absolute monarchs. Most - [The World in the Sixteenth Century](https://schoolworkhelper.net/the-world-in-the-sixteenth-century/) - The European world of the sixteenth century was a world of change. Though it still retained many of the institutions such as the Church, the universities, the manufacturing, and commercial guilds, and the feudal system of land-holding that had emerged during the Middle Ages, a new structure was developing. In religion, politics, econ­omics, and society, - [The Divine Right of Kings](https://schoolworkhelper.net/the-divine-right-of-kings/) - James I – The Divine Right of Kings The following is an excerpt from a doctrine in defense of monarchial absolutism. This document states that the king’s power is derived from the authority of God and could not therefore be held accountable for their actions by any earthly authority such as a parliament. Originating in - [Absolutism in the Age of Reason](https://schoolworkhelper.net/absolutism-in-the-age-of-reason/) - The Political Background When Louis XIV took control of his country's government in 1661 there was a good chance he might not last long. Kingship in the seven­teenth century was a dangerous occupation. For evidence he had only to look at his own family. Louis' grandfather IV Henry IV had been assas­sinated by a mad - [The Importance Of Water](https://schoolworkhelper.net/the-importance-of-water/) - As discussed in class, water is an essential of all living things. Watersheds are important to freshwater ecosystems. Watersheds are an area of land through which all water drains into a single river or lake. The runoff in a watershed can have dramatic effects on an ecosystem. Since oceans cover more than 70% of the - [Biotic and Abiotic Factors Influence on Ecosystems](https://schoolworkhelper.net/biotic-and-abiotic-factors-influence-on-ecosystems/) - Both abiotic and biotic factors determine both where an organism can live and how much a population can grow. A limiting factor is a factor that restricts the size of a population from reaching its full potential. The amount of food & water in a habitat is an example of a limiting factor. Other factors - [Writing Tips You Must Follow (or lose points)](https://schoolworkhelper.net/writing-tips-you-must-follow-or-lose-points/) - Avoid contractions (can’t, won’t, etc) unless in a quotation. Don’t use slang or common words (thing, stuff, etc), unless in a quotation. Write only in third person. Don’t use “you” or “I.” Underline the title of major works (novels, plays); use quotation marks for shorter works that can be published in an anthology (short stories, - [The Civil Rights Movement Timeline](https://schoolworkhelper.net/the-civil-rights-movement-timeline/) - Jim Crow A minstrel character of a black man, portrayed by a white man, by blackening his face with charcoal and jumping up and down and speaking with broken English the Jim Crow idea was one of many stereotypical images of black inferiority in the popular culture of the mid to late 1800’s Plessy V. - [The Founding Fathers of the United States of America](https://schoolworkhelper.net/the-founding-fathers-of-the-united-states-of-america/) - Founding Fathers Samuel Adams John Hancock John Adams Paul Revere Benjamin Franklin Thomas Paine Thomas Jefferson Alexander Hamilton Patrick Henry George Washington Samuel Adams Born 1722, Died 1803 Harvard Degree 1740 “The Son’s of Liberty” Mastermind behind the Boston Massacre propaganda campaign and the Boston Tea Party Declined to participate in the Constitutional Convention of - [Blindness And Insight In King Lear](https://schoolworkhelper.net/blindness-and-insight-in-king-lear/) - The concepts of blindness and sight are not explored by Shakespeare as physical qualities, but rather mental attributes. Blindness in characters exacerbates their ability to understand, causing misjudgment which leads to chaos in the play. This recurring theme of blindness and insight is portrayed primarily through Lear and Gloucester, who demonstrate that physical sight does - [King Lear: Clothing vs. Nakedness](https://schoolworkhelper.net/king-lear-clothing-vs-nakedness/) - Act 1 “If but as well I other accents borrow That can my speech diffuse, my good intent May carry through itself to that full issue For which I razed my likeness.” (1.4.1-4) After being banished, Kent attempts to disguise his appearance with the use of clothing in order to continue serving the KingThis disguise - [Health/Sickness and Lust in King Lear](https://schoolworkhelper.net/healthsickness-and-lust-in-king-lear/) - Related Scene: Act II Scene 1 Lines 1-51 In this scene, Edmund sets Edgar up, making him think that he has sinned against his father and the Duke of Cornwall. It is an accurate representation of the health/sickness motif that is present throughout the rest of the story. Health can be represented as “normal” and - [Albee Surrealism](https://schoolworkhelper.net/albee-surrealism/) - -The story takes place in the early morning, when it's still dark -Dark>night>dreams/nightmares -a lot of cursing (God, Jesus Christ), absurd, shocking -a lot of alcohol is consumed throughout the play -Touches on certain taboos (both personal and social) -Pregnancy before marriage (Nick married Honey because she was pregnant) -George and Martha's "son" is also - [The Great Gatsby: a liberal humanist point of view](https://schoolworkhelper.net/the-great-gatsby-a-liberal-humanist-point-of-view/) - The story of the great Gatsby can be considered a morally bad one, even though some characters face punishment for their sins. People commit sin in different ways throughout the book. Characters who commit the sin , know fully that they are doing something wrong. Daisy asks Nick to watch out “In case there’s a - [Marxist Theory in Great Gatsby](https://schoolworkhelper.net/marxist-theory-in-gatsby/) - - Looking into sociology and class systems and how they relate in this piece of literature. Implying the idea of Capitalism as mind control and getting lost in this facade of the American dream. Some in this society try and unite inequality, while others such as tom disrupt socialism and create a divide between race, - [The Great Gatsby: Surrealism](https://schoolworkhelper.net/the-great-gatsby-surrealism/) - In general: - Against the cultural and intellectual conformity - Making up events and generally arguing with each other - Imagination, dreams, and the irrational Chapter 1 - 3 -Narrator is recalling the past, dream-like -an absurdly large house -implication that Nick may be homosexual: Nick is standing next to a nearly naked man at - [The Verticals of Adam & Dr. Heidegger’s Experiment](https://schoolworkhelper.net/the-verticals-of-adam-dr-heideggers-experiment/) - In The Verticals of Adam: -The general principle –> literature follows after a mythology [set of stories with no reference to literal or historical truth] –> most complete mythology is in the Bible -Many myths add up to make a mythology, and the consistent framework for all mythology is the lass and regaining of identity - [Psychoanalysis on The Great Gatsby](https://schoolworkhelper.net/psychoanalysis-on-the-great-gatsby/) - The unconscious is important in determining behavior. A lot of desires, motivations & conflicts are below the level of consciousness. People are driven by animalistic, instinctual urges, especially lust and aggression Tom's choices in his life prove that he’s is driven by lust & aggression& like an animal on cares for his survival. Gatsby is - [Deconstruction in the Great Gatsby](https://schoolworkhelper.net/deconstruction-in-the-great-gatsby/) - Chapter 1: - “It’s up to us, who are the dominant race, to watch out or these other races will have control of things.” page 13(absurdity, mistake). Racism was common back in the 1920s, but it is not common anymore nowadays, and it is against the law. Chapter 2: - Page 28. Nick and all - [Fictional Tale Elements](https://schoolworkhelper.net/fictional-tale-elements/) - Horror: tense and profound fear, something that inspires dislike: something horrible Folklore: the traditional beliefs, customs, stories, songs, and dances of a culture Folktale: an anonymous, traditional story passed down orally, long before being written down Oral Tradition: literature that passes by word of mouth from one generation to another Myth: a traditional story of - [The History of Life and The Theory of Evolution](https://schoolworkhelper.net/the-history-of-life-and-the-theory-of-evolution/) - The Record of Life *Everything changes over time. The Earth has changed dramatically during the estimated 4.6 billion years it has existed. - All of the biodiversity present on Earth today is a result of the evolution of unicellular organisms that lived billions of years ago. - Evolution: the change in populations over time - - [Viruses and Bacteria & Immunity from Disease](https://schoolworkhelper.net/viruses-and-bacteria-immunity-from-disease/) - Viruses *Viruses and bacteria are present everywhere – in the air, on the ground, in the water, on inanimate objects, and even in and around your body. -Some of these microorganisms are important in nature’s nutrient cycles and in the food and pharmaceutical industries, while others can cause diseases. What is a virus? Virus: a - [Principles of Ecology](https://schoolworkhelper.net/principles-of-ecology/) - Organisms and Their Environment What is Ecology? -Ecology: The scientific study of interactions among organisms and their environments *Ecology reveals relationships among living and nonliving parts of the world! Ex- what a coyote eats; -how day length influences the behavior of migrating birds; -how shrimp help rid ocean fishes of parasites; -how acid rain threatens - [Foreshadowing & Point of View](https://schoolworkhelper.net/foreshadowing-point-of-view/) - Foreshadowing: clues in a story that hint about what is going to happen later in the plot -used to arouse the reader’s curiosity, to build suspense, and to help prepare the reader to accept events that occur later in the story Point of View: the perspective from which a story is told. There are three - [Dialogue Punctuation Rules](https://schoolworkhelper.net/dialogue-punctuation-rules/) - Rule 1. Use quotation marks and commas to separate speech from the speech tags. Example: -“Hello,” he said. -He said hello. -“I’m here,” she whispered. Rule 2. Quotation marks (?) and exclamation points (!) go inside quotation marks and can take the place of commas. Example: -“Who are you?” she asked. -He shouted, “Damn!” Rule - [DRAMATIC PURPOSE](https://schoolworkhelper.net/dramatic-purpose/) - I THE DRAMATIC PURPOSE OF A SCENE A specific scene in the play may be said to have dramatic purpose if it achieves one or more of the following: ¨ The revelation of the nature of important characters ¨ The revelation of opposition to or loyalty to an important character ¨ The linking of - [INTRODUCTION TO SHAKESPEARE USING ROMEO & JULIET](https://schoolworkhelper.net/introduction-to-shakespeare-using-romeo-juliet/) - ~ SHAKESPEAREAN LANGAUGE ~ Language Structure Verse – rhythm and rhyme used to help actors remember their lines, based on Greek tradition. Prose – ordinary form of written language, all language not in verse. Iamb – one unstressed syllable followed by a stressed syllable. (i.e. aLIKE) Iambic Pentameter – A line of verse that consists - [The History of the English Language](https://schoolworkhelper.net/the-history-of-the-english-language/) - Where does English come from? history of the English language really started with the arrival of three Germanic tribes who invaded Britain during the 5th century AD. the Angles, the Saxons and the Jutes, crossed the North Sea from what today is Denmark and northern Germany. At that time the inhabitants of Britain spoke a - [Lord of the Flies: Reading Guide](https://schoolworkhelper.net/lord-of-the-flies-reading-guide/) - As you read through William Golding’s Lord of the Flies, make note of the following items in each chapter. Make you responses as complete as possible. Section One: Chapter 1 How the boys got to the island Difference of Ralph and Piggy’s attitudes to the island What precedes the novel Role of the conch Attempts - [Humidity and Condensation](https://schoolworkhelper.net/humidity-and-condensation/) - *Water is the ONLY substance on Earth to commonly exist in all 3 states of matter! 1. solid- ↓ 0°C; ice, snow, hail, frost 2. liquid- 0°→100°C; rain, cloud droplets, dew 3. gas- ↑ 100°C; water vapor (The bubbles in boiling water!) *You can feel water vapor as humidity in the air! The more humid - [Air Pressure and Wind: Why does air pressure change?](https://schoolworkhelper.net/air-pressure-and-wind-why-does-air-pressure-change/) - Air Pressure: the force of air molecules exerted on a given area; the weight of the atmosphere as it pushes down upon Earth’s surface -Exerted in all directions because air molecules move in all directions. -Why aren’t we crushed by its weight? Because as the air is pushing in all around us, there are forces - [What makes the wind blow? Factors Affecting Winds & Patterns](https://schoolworkhelper.net/what-makes-the-wind-blow-factors-affecting-winds-patterns/) - Wind: the horizontal movement of air -Useful in many ways: 1. moderates surface temperatures 2. distributes moisture 3. cleanses the atmosphere -Wind is constantly blowing across Earth’s surface! -What sets the air into motion? *Differences in air pressure! -Air wants to flow from an area of high-pressure to an area of low-pressure. *For example: When - [Properties of Water & Ocean Water](https://schoolworkhelper.net/properties-of-water-ocean-water/) - Oceans cover most (~70%) of Earth’s surface, thus, Earth is sometimes called the ‘water planet’. Oceans affect all our lives by providing food, allowing transport of goods, and affecting weather and climate. Oceanography: the scientific study of the ocean and seas Properties of Water *Water is an extremely unique compound! -Solid water (ice) is actually - [Ocean Currents](https://schoolworkhelper.net/ocean-currents/) - The water in the ocean is constantly on the move. These movements, called ocean currents, usually involve large water masses and may flow at the surface or far below it. Ocean Current: any continuous flow of water along a broad path in the ocean Surface Current: an ocean current that generally flows in the upper - [Origin and Properties of the Moon](https://schoolworkhelper.net/origin-and-properties-of-the-moon/) - *Earth’s nearest neighbor in the universe is the moon! After today’s lecture, you should be able to: Explain various hypotheses about how the moon formed. Describe features and properties of the moon. Astronomy: the study of the universe The 1st probes landed on the moon in 1959. The 1st people landed on the moon in - [The Moon’s Motions & Phases](https://schoolworkhelper.net/the-moons-motions/) - *The moon travels in a regular and predictable motion. After today’s lecture, you should be able to: -Describe the motions of the moon. -Explain the reason the moon goes through phases. -Analyze how the Earth-moon-sun geometry causes lunar and solar eclipses. *Like the sun, the moon rises in the east and sets in the west, - [The Sun’s Size, Heat, and Structure](https://schoolworkhelper.net/the-suns-size-heat-and-structure/) - *The sun affects our lives in more ways than we can imagine (even though it is about 150 million km away!): produces heat, light, energy for photosynthesis, food, wind, ocean currents, tides, radiation, weather, etc. After today’s lecture, you should be able to: -Explain the structure of the sun and its energy source. -Describe the - [The Planets: Formation of the Solar System](https://schoolworkhelper.net/the-planets-formation-of-the-solar-system/) - A great cloud of gas and dust (called a nebula) begins to collapse and spin Nebula begins to flatten into a spinning pancake shape with a bulge at the center This is due to forces of gravity and rotation Further collapse causes certain regions to condense into the sun, planets, and moons In the center - [A Closer Look at Light](https://schoolworkhelper.net/a-closer-look-at-light/) - *Astronomers analyze light from objects in space in order to learn about the composition and movement of the objects. After today’s lecture, you should be able to: - Describe the characteristics of electromagnetic radiation. - Explain ways of analyzing light in order to get information about stars. - Explain the Doppler Effect and how it - [Constellations, Galaxies, and the Universe](https://schoolworkhelper.net/constellations-galaxies-and-the-universe/) - *Billions of galaxies make up the universe, which, according to the big bang model, formed between 10 & 20 billion years ago. After today’s lecture, you should be able to: -Tell what a galaxy is and describe the various types of galaxies. -Explain the origin of the universe according to the big bang model. A) - [Analysis of Scientific Experiments (Scientific Method)](https://schoolworkhelper.net/analysis-of-scientific-experiments-scientific-method/) - In order to create and perform scientific experiments, you must first become aware of the parts that are involved in designing an appropriate experiment, as well as the vocabulary that is associated with each part. Vocabulary associated with scientific experiments: -variable: any part of an experiment that can vary -control: any part of the experiment - [Modeling the Planet](https://schoolworkhelper.net/modeling-the-planet/) - *In order to be able to learn more about Earth as a whole, we must be able to look at it as a whole, and be able to see and find areas of particular interest. *A map is a flat, 2-dimensional representation of Earth’s surface. -cartographer: mapmaker -projections: the different ways in which maps can - [Topographic Maps](https://schoolworkhelper.net/topographic-maps/) - Topographic maps are made specifically to show elevation. They show elevation through the use of contour lines. *The mountain below has 1 peak! 4000m What is the lowest elevation of this mountain? 1000 m PLEASE NOTE: Not every elevation can be represented by a contour line. Index contours: bold contour (lines used to calculate the - [How Rocks Form: Igneous Rocks, Sedimentary Rocks, Metamorphic Rocks](https://schoolworkhelper.net/how-rocks-form-igneous-rocks-sedimentary-rocks-metamorphic-rocks/) - Why Study Rocks? -Many, many uses! – writing tools (chalk, pencils), building materials (marble, concrete), fuels (coal), scouring powder (pumice, sand), weapons (flint, obsidian) Rock: a group of minerals bound together - Found in the Earth’s crust and mantle The Rock Cycle: the continuous process of rock formation and change - Presents a “map” of the - [Mineral Resources: Renewable & Nonrenewable](https://schoolworkhelper.net/mineral-resources-renewable-nonrenewable/) - Earth has renewable and nonrenewable resources. Our demand for and use of resources sometimes exceeds the supply that is available. Renewable resource: one that can be replaced in nature at the same rate in which we use it Nonrenewable resource: one that exists in a fixed amount, or is used up faster than it can - [Energy Resources: Renewable & Nonrenewable](https://schoolworkhelper.net/energy-resources-renewable-nonrenewable/) - We depend on a variety of energy resources, both renewable (R) and nonrenewable (NR), to meet our energy needs. Most used energy sources in the world: oil: NR; 50-year life expectancynatural gas: NR; 125-year life expectancycoal: NR; 200-300 year life expectancywater power: R;uranium (nuclear power): NR; ?? *The top 3 energy resources used in the - [What are Plate Tectonics?](https://schoolworkhelper.net/what-are-plate-tectonics/) - The lithosphere is broken into rigid plates that move in relationship to one another on the asthenosphere. Plate Tectonics: a theory that describes the formation, movements, and interactions of these plates. Continental Drift: an early hypothesis about plate movement that says the continents drifted from one location to another over time. -Proposed in 1912 by - [Reconstructing the Past & Causes of Plate Movement](https://schoolworkhelper.net/reconstructing-the-past-causes-of-plate-movement/) - Causes of Plate Movement -Remember that the lithosphere (crust + upper mantle) is solid and is floating on the asthenosphere (melted rock in the mantle below the lithosphere). 1. Heat from the Earth’s core is transferred throughout the mantle. 2. Magma that is hotter and less dense rises upward at a mid-ocean ridge. 3. Once - [How and Where Volcanoes Form](https://schoolworkhelper.net/how-and-where-volcanoes-form/) - Volcanoes form where magma reaches Earth’s surface. Volcano: the opening in Earth’s crust through which magma, gases, and ash erupt, and the landform that develops around this opening *A volcanic eruption occurs when magma rises to the surface. -How does this magma form? 3 ways: 1. A decrease in pressure- lowers melting temperature and allows - [Physics: Lab Report Style](https://schoolworkhelper.net/physics-lab-report-style/) - Labs are performed in groups for data collection purposes only. Your lab report should NOT be the result of shared writing, copying, or cooperative effort. This includes your calculations. You must do this on your own. Remember to cite any references you use and do not copy from the lab sheets into your lab report. GRAPHS MUST - [FREEDOM: THE STRUGGLE FOR CIVIL LIBERTIES](https://schoolworkhelper.net/freedom-the-struggle-for-civil-liberties/) - Civil Liberties in the Constitution Civil liberties are constitutional provisions, laws, and practices that protect individuals from governmental interference. Found primarily in the Bill of Rights. They protect us from the government. Civil rights are guarantees by government of equal treatment to all citizens. (The word equality does not appear in the Constitution.) Constitutional liberties - [Legal Formalism & Conservatism](https://schoolworkhelper.net/legal-formalism-conservatism/) - In the eighteenth century, the famous British jurist, Sir William Blackstone (1723-1780) pronounced that judges do not make the law, they merely "find" it. This comment represents an attitude toward the law that grew in strength in Britain and the United States in the nineteenth century and persists today, especially in Britain and, to some - [Positive Law: Thomas Hobbes, Jeremy Bentham, John Austin](https://schoolworkhelper.net/positive-law-thomas-hobbes-jeremy-bentham-john-austin/) - During the 16th and 17th centuries, England was consumed by religious, political, and social upheaval that included a civil war and the beheading of a king. It was a period of extreme violence, fear, and lawlessness. The theory of natural law – that law is based on divine revelation and that it was put in - [Strawberry DNA Extraction Lab](https://schoolworkhelper.net/strawberry-dna-extraction-lab/) - All living things have DNA: the chemical instructions on how to make a living thing. It can easily be seen with the naked eye when collected from thousands of cells. This simple method allows you to extract DNA from a strawberry and view it. Materials (per group): * 1 Strawberry * 1 Zip-closure sandwich bag - [Sea Star: Dissection](https://schoolworkhelper.net/sea-stardissection/) - Introduction: Echinoderms are radially symmetrical animals that are only found in the sea (there are none on land or in fresh water). Echinoderms mean "spiny skin" in Greek. Many, but not all, echinoderms have spiny skin. There are over 6,000 species. Echinoderms usually have five appendages (arms or rays), but there are some exceptions. Radial - [Clam Dissection Lab: Explained](https://schoolworkhelper.net/clam-dissection/) - IntroductionThe phylum Mollusca includes snails, clams, chitons, slugs, limpets, octopi, and squid. As mollusks develop from a fertilized egg to an adult, most pass through a larval stage called the trocophore. The trocophore is a ciliated, free-swimming stage. Mollusks also have a radula or file-like organ for feeding, a mantle that may secrete a shell, - [Conservation Biology: Extinction, Habitat Loss, Invasive Species, Overexploitation](https://schoolworkhelper.net/conservation-biology-extinction-habitat-loss-invasive-species-overexploitation/) - SPECIES EXTINCTION Species can become extinct: Locally: A species is no longer found in an area it once inhabited but is still found elsewhere in the world. Ecologically: Occurs when so few members of a species are left they no longer play its ecological role. Globally (biologically): Species is no longer found on the earth. - [Grasshopper Information and Dissection](https://schoolworkhelper.net/grasshopper-information-and-dissection/) - Introduction: Insects are arthropods with jointed appendages, segmented bodies, and an exoskeleton composed of chitin. Insects are in the class Insecta, & are the largest and most diverse group of animals on earth. The genus Romalea is a large grasshopper common in the southeastern United States. Insects have three body regions (head, thorax, & abdomen), - [Frog Dissection: Background & Urogenital System](https://schoolworkhelper.net/frog-dissection-background-urogenital-system/) - Background: As members of the class Amphibia, frogs may live some of their adult lives on land, but they must return to water to reproduce. Eggs are laid and fertilized in the water. On the outside of the frog’s head are two external nares, or nostrils; two tympani (tympanic membranes), or eardrums; and two eyes, - [How to Take Good Notes & Best Note Taking Skills](https://schoolworkhelper.net/how-to-take-good-notes-best-note-taking-skills/) - Ask yourself: Do I use complete sentences? Do I use any form at all? Are my notes clear or confusing? Do I capture the main points and all sub-points? Do I streamline using symbols, abbreviations, and shortcuts? 6 Important Reasons to Take Notes It helps you to concentrate in class. It helps you prepare for - [Lab: How is the Surface Tension of Water Affected By Soap?](https://schoolworkhelper.net/lab-how-is-the-surface-tension-of-water-affected-by-soap/) - Introduction: Surface tension refers to water's ability to "stick to itself", due to the forces of cohesion. Surface tension can be measured and observed by dropping water (drop by drop) onto a penny. The number of water drops that can fit on a penny will surprise you. Initial Observation: Observe surface tension by seeing how - [Phylum Arthropoda, Echinodermata, Chordata](https://schoolworkhelper.net/phylum-arthropoda-echinodermata-chordata/) - The largest animal phylum- 1 million species of crabs, shrimp, spiders, scorpions, and insects make up this phylumHave jointed appendages; segmented bodiesExoskeletons made of chitinMolt; have heads with many sensory organs.BilateralSimple and complex eyes that detect only light intensity and form imagesAntennae that smell chemical substances in the environmentSexual Reproduction- where sperm is released inside - [Kingdom: Fungi Characteristics & Structure](https://schoolworkhelper.net/kingdom-fungi-characteristics-structure/) - A review article of fungi characteristics, fungi nutrition, fungi classification and the benefits of fungi. - [KINGDOM ANIMALIA: General Characteristics of Animals](https://schoolworkhelper.net/kingdom-animalia-general-characteristics-of-animals/) - Characteristics of Life Living things are organized.Living things are made up of cells.Living things metabolize. Living things maintain an internal environment.Living things grow. Living things respond.Living things reproduce.Living things evolve. Seven Levels of Taxonomic Classification KingdomPhylumClass OrderFamily GenusSpecies Kingdom Animalia Characteristics All animals are multicellular, eukaryotic heterotrophs —they have multiple cells with mitochondria and they - [Biotic Relationships: Commensalism, Niche, Parasitism](https://schoolworkhelper.net/biotic-relationships-commensalism-niche-parasitism/) - Niche An organism’s ecological ROLE in the environment (NOT HABITAT!) All components of lifestyle and how they affect other organisms Three Types of Symbiosis Mutualism both species benefit Commensalism one species benefits, the other is unaffected Parasitism one species benefits, the other is harmed Lichen Lichen is really two organisms: algae and fungus. The fungus - [Political and State Power in Great River Valley Societies](https://schoolworkhelper.net/political-and-state-power-in-great-river-valley-societies/) - State Leader & Symbolic Role Method of Unification Ruler’s Means of Control Egypt Pharoh (herdsman) sometimes functions as god. Organizing labor to manage floods; distribution of food; use of Nile River as highway to unify, control. Pharaoh’s commands, policies function as law, regarded as devine. Mesopotamia city-states King/Royals, mediate, lead, worship, receive oracles. Organizing labor; - [Point of View Definition](https://schoolworkhelper.net/point-of-view-definition/) - DEFINITION: Identifying Point of View (POV) is an attempt at establishing an author's bias and/or motivation within a primary source. Clarifying an author's logic in his/her opinions is a form of high level analysis. SOME METHODS OF IDENTIFYING POINT OF VIEW: Political ideology, Class, Race, Religion, Nationality, Profession, Gender POV is NOT: An author's opinion. - [Foundations to 600 CE Trade Routes and their Connections](https://schoolworkhelper.net/foundations-to-600-ce-trade-routes-and-their-connections/) - Route: Indian Ocean Advantages: Changeable, predictable monsoon wids lead to reliable schedules; great variety and amound of goods can be carried via ship (emporium trading); seaborne trade usually faster than land routes Geographical Scope: East Africa, Arabia, Inida, S.E. Asia; canal between Red Sea and Nile would eventually connect Mediterranean Commerce: Aromatic (incense), spices, gold, - [Bill of Rights](https://schoolworkhelper.net/bill-of-rights/) - First Amendment – Establishment Clause, Free Exercise Clause; freedom of speech, of the press, and of assembly; right to petition. Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, - [Economic History](https://schoolworkhelper.net/economic-history/) - -From the start there exists a materialist connection of humans with one another, i.e., the satisfaction of basic needs. - The first historical act is the act of production of the means to satisfy these needs, the production of material life itself. -Humans work on nature and through that relation emerges a cultural system of - [FOOD PREPARATION TECHNIQUES](https://schoolworkhelper.net/food-preparation-techniques/) - TECHNIQUE DEFINITION Bake To cook breads, cookies, veggies, casseroles and some meats in an oven. Beat To thoroughly mix ingredients by stirring rapidly in a circular or over and over motion. Blend To mix two or more ingredients together until combined. Also known as combining ingredients. Boil To cook food in a liquid that - [FOOD ALLERGIES & ANAPHYLAXIS](https://schoolworkhelper.net/food-allergies-anaphylaxis/) - The difference between an allergy and intolerance: Food Allergy Occurs when the immune system reacts to a certain food The body creates immunoglobin E (IgE) When these antibodies react with food the body releases massive amounts of chemicals and histamines to protect the body – causing a number of symptoms of an allergic reaction Food - [Dihybrid Crosses](https://schoolworkhelper.net/dihybrid-crosses/) - Dihybrid cross = involves inheritance of 2 characteristics Example 1: In Pisum sativum, a round seed is produced by a dominant allele (R), while wrinkled seeds are produced by the recessive allele (r). Yellow seeds are produced by the dominant allele (Y), while green seeds are produced by the recessive allele (y). In a cross - [What is a foodborne illness?](https://schoolworkhelper.net/what-is-a-foodborne-illness/) - Foodborne illness, often called ‘food poisoning’, occurs when a person gets sick by eating food that has been contaminated with bacteria, parasites or viruses, also known as ‘microbes’ and ‘pathogens’. Foodborne illness is the largest class of emerging infectious diseases. This is due to the changing population demographics, changing patterns of food production and consumption - [Body Types (Somatype)](https://schoolworkhelper.net/body-types-somatype/) - Attempting to enter the basic American search for self-control, individuality and thinness has not brought most people more health and happiness. Instead, we often feel as if we have failed and the blame is laid squarely on our shoulders. But the social requirement that we achieve the "ideal weight" is based on the presumption that - [TIPS FOR A POSITIVE BODY IMAGE](https://schoolworkhelper.net/tips-for-a-positive-body-image/) - Do you loathe and despise your body? Or maybe you wish if you could just change this one thing... Well, you're not alone. Far from it. Whether you feel you are too fat, too skinny, too tall, too short, too hairy, not hairy enough, too-something -- or just not something enough –- everyone feels like - [Male Image Issues](https://schoolworkhelper.net/male-image-issues/) - Men are subject to issues concerning body image as much as women. Currently, two competing body types dominate the pages of GQ and Men's Health. The first is a slender, sculpted, almost feminine look (think Brad Pitt); the second is a pumped-up but still low-fat physique (think Nicolas Cage). Both images differ greatly from past - [Tips for Staying Healthy: Losing Fat & Gaining Muscle](https://schoolworkhelper.net/tips-for-staying-healthy-losing-fat-gaining-muscle/) - Practice Healthy Eating Habits One of the good points about many of the popular low carbohydrate diets is that they draw attention to the quality of the carbohydrates that we’re eating. Most Americans are choosing lots of refined, sugary, calorie-rich (but nutrient-poor) carbohydrates like soda, candy, white bread products, white rice, and processed french fried - [The Diet Industry](https://schoolworkhelper.net/the-diet-industry/) - The diet business is fat and healthy. Anyone who swigs diet soda, works out regularly or subsists on fat-free food, is feeding this multi-billion dollar industry. Annual diet industry revenues have grown from an estimated $100 million in the 1950s to $50 billion in the 1990s. The industry encompasses all products and services that claim - [Eating Disorder: Anorexia Nervosa](https://schoolworkhelper.net/eating-disorder-anorexia-nervosa/) - Definition An eating disorder characterized by the refusal or inability to eat which creates a state of self-starvation. Characteristics Victims have a severe distortion of body image and extreme concern about appearances. Use voluntary starvation, excessive exercise and diet pills to try and achieve idealized body proportions. Have an obsession with food and calories. Physical - [Eating Disorder: Binge-Eating Disorder](https://schoolworkhelper.net/eating-disorder-binge-eating-disorder/) - Definition An eating disorder characterized by massive food binges (similar to Bulimia Nervosa) without the purging or other compensating behaviours. Characteristics Periods of eating compulsively and consuming large quantities of food until the individual is uncomfortably full, followed by feelings of guilt and shame which lead to secretive eating. Use food as a way to - [Eating Disorder: Bulimia Nervosa](https://schoolworkhelper.net/eating-disorder-bulimia-nervosa/) - Definition An eating disorder characterized by massive food binges followed by purging or other compensating behaviours to try and rid the body of unwanted calories. Characteristics Uncontrollable eating in excess followed by self-induced vomiting or misuse of diuretics and laxatives, fasting or excessive exercise to avoid weight gain. Feelings of guilt and shame, which lead - [Thomas Robert Malthus: Food & Population](https://schoolworkhelper.net/thomas-robert-malthus-food-population/) - Malthus based his ideas about population and food on two basic premises. 1) Food is necessary to sustain life 2) Human sexual instinct is constant. Starting with these two premises, Malthus built an argument that the population if unchecked would double every 25 years (about one generation) Population would progress geometrically Food production would be - [Critique of Adam Smith](https://schoolworkhelper.net/critique-of-adam-smith/) - It has been argued that Adam Smith articulated two essential attributes in the economic system that was not yet fully born in his time: 1. A society of competitive profit-seeking individuals can assure its orderly material provisioning through the self-regulating market system. 2. Such a society tends to accumulate capital, and in doing so enhances - [Philosophers of Law](https://schoolworkhelper.net/philosophers-of-law/) - If good is to be rewarded and evil is to be punished, how do we define good and evil? Should we be obeying the law no matter what the content? What if the law itself is evil? The philosophers we will be looking at are a few of the influential thinkers of their day. Ancient, - [The Love Song of J. Alfred Prufrock](https://schoolworkhelper.net/the-love-song-of-j-alfred-prufrock/) - Themes: loneliness, indecision, and love. Prufrock is a man whose anxieties have isolated him. He doesn’t make decisions because he fears that they will turn out wrong He talks about love and about women Voice: J. Alfred Prufrock is speaking the poem (persona) Tone: it does change throughout the poem because at one point, he - [Ode on a Grecian Um Analysis](https://schoolworkhelper.net/ode-on-a-grecian-um-analysis/) - The statues ‘talk’ to you Life size renditions in bronze A whole room “frieze”- small tiles used to decorate the room and tell a story Dig for a subway- and find a village- with an intact water system (4000 year old) Keats’ Message “What leaf - fring’d legend haunt about thy shape Of deities or - [Canada’s Aboriginal Communities](https://schoolworkhelper.net/canadas-aboriginal-communities/) - Key Terms Aboriginal Peoples: Descendents of Canada’s original inhabitants Treaty: An official agreement between the federal government and the First Nations – Aboriginal people give up their land rights (except for reserves) and accept treaty money/government assistance Reserve: Area of land set aside for status Indians Assimilate: To lose your culture and adopt the culture - [Canada’s Agricultural Resources: Disappearing Farmland](https://schoolworkhelper.net/canadas-agricultural-resources-disappearing-farmland/) - There are five major agricultural production sectors in Canada. They are….. grains & oilseeds (wheat, oats, rye, flax seed, canola, soybeans, and corn ) 34% red meats (beef, hog, veal, lamb) 27% dairy 12 % horticulture 9% poultry and eggs 8% Horticulture, poultry & eggs, and dairy are all produced with a domestic orientation – - [Softwood, Hardwood, Shelterwood, Selective Cutting Forestry](https://schoolworkhelper.net/softwood-hardwood-shelterwood-selective-cutting-forestry/) - Softwood Forests: coniferous trees (cone-bearing: fir, pine, spruce) make up 66% of Canada’s forests Hardwood Forests: deciduous trees (lose leaves every year: birch, maple) make up 12% of Canada’s forests Commercial Forests Trees are harvested to make a profit exists in warmer, wetter areas where trees grow quickly British Columbia, Alberta Non-commercial Forests Not profitable - [Mining: Economic, Environmental, Types](https://schoolworkhelper.net/mining-economic-environmental-types/) - Minerals are non-renewable resources found all over the world The Canadian Shield is the source of many of our mineral deposits Minerals can be divided into three groups: Metallic (copper, nickel, uranium, gold, etc) Fossil Fuels (coal, oil, natural gas) Industrial (stone, diamonds, salt, potash) Environmental Issues Mining can cause air pollution, acid precipitation, and - [Latitude and Longitude: Lines on the Earth](https://schoolworkhelper.net/latitude-and-longitude-lines-on-the-earth/) - Latitude o imaginary lines that measure the distance north or south of the Equator (0°) o lines are parallel to the Equator at regular intervals (approximately 113 kilometres apart) What is Latitude? Its reference point is the equator. The equator’s latitude is O degrees. Even though the lines run horizontally, latitude measures north and south. - [Ionic & Covalent Bond Interactions](https://schoolworkhelper.net/ionic-covalent-bond-interactions/) - After reviewing the Bohr-Rutherford diagram you should know that atoms wish to “fill” electron orbits. Atoms tend to combine in a way that allows the resultant compound to be neutral but have only full electron orbits on the atoms. Lets do an example: Note: I draw the electrons with holes in noticeable places. In reality - [Protons, Neutrons, Electrons, Isotopes](https://schoolworkhelper.net/protons-neutrons-electrons-isotopes/) - Isotopes have the same number of protons, but different numbers of neutrons.This means that while the atomic number of an element will NEVER change…The MASS of the atom can change quite a bit depending on how many neutrons there areThe number of protons in an atom is also called the “atomic number”. This number is - [Confederation in Canada: History and Contributions](https://schoolworkhelper.net/confederation-in-canada-history-and-contributions/) - Confederation Day July 1, 1867 – Canada first became a nation – BNA Act 4 British colonies joined to form the new Dominion of Canada Ontario, Quebec, Nova Scotia & New Brunswick (population = 3 million) John A. McDonald sworn in as Canada’s first prime minister The Twentieth Century (1900-1913) Some colonies rejected confederation – - [The Causes of World War I](https://schoolworkhelper.net/the-causes-of-world-war-i/) - Militarism Alliances Imperialism Nationalism Militarism Def: Building up of arms (weapons) to deter (scare) others from attacking. Germany was competing with the UK to build battleships. The British feared an attack on their Empire Germany was competing with Russia and France to expand their armies Alliances Def: Banding together of countries against a common threat. - [Propaganda in World War One](https://schoolworkhelper.net/propaganda-in-world-war-one/) - What is Propaganda? Propaganda is a specific type of message presentation aimed at serving an agenda. The purpose of propaganda is 'to spread a philosophy or point of view'. The most common use of the term (historically) is in political contexts; in particular to refer to certain efforts sponsored by governments or political groups. Each - [Traditions of Parliamentary System](https://schoolworkhelper.net/traditions-of-parliamentary-system/) - Canadian Parliamentary System Federal Level Provincial Level Constitutional Monarchy A government in which the monarch has only the powers laid out in the nation’s constitution and laws. The monarch is recognized as the Head of State and centre of state authority. Role is essentially symbolic; most real political power in Canada lies with elected politicians. - [Introduction to Law Terms](https://schoolworkhelper.net/introduction-to-law-terms/) - SUBSTANTIVE LAW: Consists of laws that list the rights and obligations of each person in society. PROCEDURAL LAW: Is the process of the law; outlines the steps in involved in protecting the rights given under substantive law. PUBLIC LAW: Controls the relationship between the governments and the people who live in society. Main types: criminal, - [WHY DO BUSINESSES FAIL?](https://schoolworkhelper.net/why-do-businesses-fail/) - PERSONAL CHARACTERISTICS OF THE ENTREPRENEUR (RISK TAKER, GO GETTER ETC.) UNWILLINGNESS TO DEVOTE THE IMMENSE AMOUNT OF TIME AND EFFORT REQUIRED TO MAINTAIN THE BUSINESS. THEY MAY HAVE TO LITTLE KNOWLEDGE OF THE BUSINESS AND HOW TO RUN IT. FAILURE TO DEVISE AN ADEQUATE FINANCIAL PLAN FOR THE BUSINESS AND TO ASSESS ITS ABILITY TO - [What is Rhetoric? Rhetorical Conventions & Structure](https://schoolworkhelper.net/what-is-rhetoric-rhetorical-conventions-structure/) - Rhetoric essentially means the art of speaking persuasively.It is the use of language in a formalized way in order to convince or have an effect on an audience. A) Word order Manipulation of common word order to create an effect B) Word choice Figurative language (oxymoron, onomatopoeia, assonance, alliteration, hyperbole, understatement, irony, allusion, litotes, pun)Jargon, - [What is Location, Time, Space, Tone, Tropology?](https://schoolworkhelper.net/what-is-location-time-space-tone-tropology/) - Location Location is the arrangement and presentation of physical and temporal elements in a work. Time time of year (season) time of day (morning, afternoon, evening) month (September, January) era, century, decade (Victorian, 20th century, 1920’s) duration of the narrative details of the passage of time (falling leaves – autumn, snow – winter) sequencing of - [Elements of Cognitive Design](https://schoolworkhelper.net/elements-of-cognitive-design/) - Cognitive design is defined as the crafted impact a piece of writing has on its audience. Central to this design are the subject and theme of the work. The subject is what the work is about. The theme is the attitude the author has taken toward the subject or the perspective on that subject. This - [Power, Economy, Political, Religion during the Renaissance](https://schoolworkhelper.net/power-economy-political-religion-during-the-renaissance/) - Power, Economy, Political, Religion during the Renaissance Global balance of power: Expansion, Wars, MigrationEconomyPoliticalReligion/Cosmology ------------------------------------------------------------------------------------------------ 1. Expansion, Wars & Migration ▪Largest Empire after the fall of Rome was the Islamic Empire. ▪Under the leadership of Dynastic Arab & Turkish families, Islam (originating in Saudi Arabia) spread from Spain to India by the 13th C., effectively - [The Bohr Atomic Theory](https://schoolworkhelper.net/the-bohr-atomic-theory/) - Once the ideas of Planck and Einstein (re: quanta) had been accepted, the study of atomic and molecular structure began. With the invention of the spectroscope (Bunsen & Kirchhoff, Fig 2/175) the quantitative analysis of the atomic spectra of elements began. The range of frequencies of light emitted or absorbed by an atom is called - [The Matrix of Jurisprudence](https://schoolworkhelper.net/the-matrix-of-jurisprudence/) - Jurisprudence Juris- of law or of right Prudens/Prudentia-knowledge or skill of the law. Science or Philosophy of the Law Dealing with concepts, principles, notions of legal thought Look below surface of laws, court decisions and legal institutions Historical and Philosophic Roots Legal Matrix= Puzzle Interlocking Concepts, theories, principles and institutions. Law more than just rules - [Purpose and Function of Laws](https://schoolworkhelper.net/purpose-and-function-of-laws/) - LAW is a set of rules of conduct, established by government, for all members of society to obey and follow. The Function of Law 1. Regulates conduct- acts as a deterrent i.e. if you do “x” you face punishment “y”.2. Avoids or Settles disputes – Contract law sets out rules for making & enforcing agreements.3. - [Key Figures of Ancient Egypt (New Kingdom)](https://schoolworkhelper.net/key-figures-of-ancient-egypt-new-kingdom/) - Hatshepsut female ruler around 1470 BCE wore beard to symbolize power husband was Tutmosis II Tuthmosis III was her stepson first powerful female leader ruler in own right peace & prosperity expanded trade built massive tomb & 2 obelisks death-unknown Tuthmosis III inherited throne from father through stepmom around 1450 BCE training in military “Napoleon - [WHY DO PEOPLE TRAVEL? TRAVEL MOTIVATORS](https://schoolworkhelper.net/why-do-people-travel-travel-motivators/) - PERSONAL Curiosity, desire to learn about an area, enhance self esteem, stress relief (need to get away), improve health, recreation Ex. Weekend Getaway ENVIRONMENTAL Desire to experience different landscapes, check out different types of wildlife, enjoy outdoor experiences Ex. Safari CULTURAL Desire to explore art, history, food, religion, language, etc., may be something from your - [RESPONSIBLE TOURISM TIPS](https://schoolworkhelper.net/responsible-tourism-tips/) - There are many ways to travel responsibly and still have fun! Here are some good tips to be a responsible traveller: Don’t always go for the pre-packaged vacation – it is convenient, but much of your money spent goes to big companies, rather than to support the local economy of the place you are visiting. - [Introduction to Archaeology](https://schoolworkhelper.net/introduction-to-archaeology/) - Archaeology involves controlled methods of survey and excavation, aimed at recovering objects and remains which provide information about the structures and activities of people in the past. The relationships of these objects and remains can be reconstructed, and aspects of their cultural meaning determined. Since so much of the material which survives the passage of - [Earliest Civilization: the Fertile Crescent & Mesopotamia](https://schoolworkhelper.net/earliest-civilization-the-fertile-crescent-mesopotamia/) - Categorized as the earliest of all civilizations as people formed permanent settlements Mesopotamia is a Greek word that means “between the rivers” Specifically, the area between the Tigris River and Euphrates River (present day Iraq) Mesopotamia is not within the "Fertile crescent“, it is in the more desert area that the "Fertile crescent" arcs around - [Tools and Science of Archaeology](https://schoolworkhelper.net/tools-and-science-of-archaeology/) - Archaeologists are basically detectives who attempt to reconstruct past human activities from evidence most of which is buried in the earth. Archaeology involves experts from many other fields. Even the science of archaeology, commonly divided into prehistoric and historical can be further divided into various fields: paleolithic, Egyptology, classical, industrial, environmental, underwater, salvage, and experimental - [The Code of Hammurabi](https://schoolworkhelper.net/the-code-of-hammurabi/) - 1) If any one bring an accusation against a man, and the accused go to the river and leap into the river, if he sink in the river his accuser shall take possession of his house. But if the river prove that the accused is not guilty, and he escape unhurt, then he who had - [FACTS ABOUT CANADA](https://schoolworkhelper.net/facts-about-canada/) - Canada: Kanata: Indian word used by J. Cartier meaning the settlement (village) of a group of people Population of 31 million + 77% of its population lives in urban areas (cities) Average family size is 1.2 children 3% of Canada’s population are Aboriginals Capital city is Ottawa, found in Ontario 4/5ths of Canada’s population is - [The Cover Letter: Guide and Format](https://schoolworkhelper.net/the-cover-letter-guide-and-format/) - Whenever you send a resume out to an employer, you should always send an accompanying letter that explains why you are contacting them. This letter is called the covering letter. (Send a cover letter even when faxing.) If the employer receives a resume without a covering letter, he or she may be asking him or - [Romeo & Juliet Act I, Scene 1 Analysis](https://schoolworkhelper.net/romeo-juliet-act-i-scene-1-analysis/) - Key players Sampson/Gregory: Servants to CapuletAbraham/Balthasar: Servants to MontagueBenvolio: Nephew of Montague, Romeo’s friendTybalt: Nephew of Lady CapuletCapulet: Head of household feuding with MontaguesLady Capulet: Wife of CapuletPrince (Escalus): Prince of VeronaMontague: Head of household feuding with CapuletsLady Montague: Wife of MontagueRomeo: Son of Montague Summary of key events Two servants from the house of - [Romeo & Juliet: Act I, Scene 2 Analysis](https://schoolworkhelper.net/romeo-juliet-act-i-scene-2-analysis/) - Key players Capulet: Head of household feuding with Montagues Paris: A young nobleman, relative of the Prince Benvolio: Nephew of Montague, Romeo’s friend Romeo: Son of Montague Summary of key events The scene opens with Paris, a noble young kinsmen of the Prince, asking Capulet for his daughter’s hand in marriage. Capulet tells Paris that - [Romeo & Juliet: Act I, Scene 3 Analysis](https://schoolworkhelper.net/romeo-juliet-act-i-scene-3-analysis/) - Key players Lady Capulet: Wife of Capulet Nurse: Juliet’s helper Juliet Capulet: Daughter of Capulet Summary of key events Back at Capulet’s house, Lady Capulet visits her daughter’s chamber to tell her about Paris. Juliet’s nurse is in the room and she begins to ramble, recounting Juliet as a young child: “For then she could - [Romeo & Juliet: Act I, Scene 4 Analysis](https://schoolworkhelper.net/romeo-juliet-act-i-scene-4-analysis/) - Key players Romeo: Son of Montague Benvolio: Nephew of Montague, friend of Romeo Mercutio: Relative of the Prince, friend of Romeo Summary of key events The festivities are about to commence at the house of Capulet and, concealed amidst the Masquers, Romeo and Benvolio arrive with their close friend, Mercutio. Stifled by “love’s heavy burden”, - [Romeo & Juliet: Act I, Scene 5 Analysis](https://schoolworkhelper.net/romeo-juliet-act-i-scene-5-analysis/) - Key players Capulet: Head of household feuding with the MontaguesRomeo: Son of MontagueTybalt: Nephew of Lady CapuletJuliet: Daughter of CapuletNurse: Juliet’s HelperBenvolio: Nephew of Montague, a friend of RomeoFirst Servant/Second ServantSecond CapuletServant Summary of key events In the hallway of Capulet’s house, four serving-men clear away the dinner dishes. Lord Capulet comes out to greet - [How to Summarize](https://schoolworkhelper.net/how-to-summarize/) - What is a summary? A summary paragraph re-states the main idea of the text A summary is usually 1/3 length of original text A summary is written in your own words A summary is written in 3rd person (no I, me, you...) A summary is NOT: Written in 1st person Your opinion on the topic - [Psychology Study Methods, Research, Validity](https://schoolworkhelper.net/psychology-study-methods-research-validity/) - Key scientific attitudes: Curiosity, skepticism, open-mindedness Hindsight: explaining behavior after the fact (problem: multiple conflicting outcomes and explanations for results) Use Scientific Process with variables and factual observations Scientific Process: Formulate a question based on observed events Formulate a tentative explanation for why those event transpired (hypothesis) Conduct research to test it Analyze research and - [Statistics in Psychology: Variance, Deviation](https://schoolworkhelper.net/statistics-in-psychology-variance-deviation/) - Descriptive Statistics: Summarizes and describes characteristics of a set of scores for a groupFrequency Distribution: # of people who received each scoreHistogram: frequency distribution turned into a graph.The measure of central tendency: mean (average), median (middle), mode (most often) The measure of variability: provide info about the spread of scores (i.e range) (highest- lowest) least - [Brain Structure: Depolarization & Neurotransmitters](https://schoolworkhelper.net/brain-structure-depolarization-neurotransmitters/) - Neurons: constructive unit of the nervous system; interconnected like electrical circuits Made up of: Soma (cell body): contains nucleus, keeps nerve cells alive (grey matter) Dendrites: receiving portion of nerve cell- receiving end of cell Axon: sends impulses away from the cell (white matter) Dendrites and axons are all interconnected; vary in shape and size - [Brain: Imaging, Anatomy, Lateralization](https://schoolworkhelper.net/brain-imaging-anatomy-lateralization/) - Scores on neuropsychological tests show amount of damage done to person Destruction and Stimulation test: can destroy parts of the brain to see effect or stimulate nerves with electrodes (Dr. Penfield- famous neuroscientists) – mapped motor and sensory areas Broca’s aphasia: could understand, but not speak Dorsal Stream: action (D.A) Ventral Stream: perception (V.P) Single- - [Psychology: The Science of Behaviour](https://schoolworkhelper.net/psychology-the-science-of-behaviour/) - Psychology = The scientific study of behaviour and the factors that influence it. Taking into account Biological, Individual and Environmental factors. Basic and Applied Science Two types of research: Basic research: Knowledge gained purely for its own sake. The goals are to describe how people behave and to identify factors that influence it. Research maybe - [Sensation and Perception](https://schoolworkhelper.net/sensation-and-perception/) - Sensation – the stimulus-detection process by which our sense organs respond to and translate environmental stimuli into nerve impulses that are sent to the brain Perception – active process of organizing the stimulus input and giving it meaning Sensory Processes Stimulus detection – absolute threshold designated as the lowest intensity at which a stimulus can - [States of Consciousness](https://schoolworkhelper.net/states-of-consciousness/) - Consciousness – our moment to moment awareness of ourselves and our environment Has various characteristics: Subjective and Private – reality and experience depend on the individual Dynamic – consciousness experiences are ever-changing and a continuous flow of mental activity Self-reflective and Central to Our Sense of Self – mind is aware of its own consciousness - [Learning: Classical Conditioning & Operant Conditioning](https://schoolworkhelper.net/learning-classical-conditioning-operant-conditioning/) - Learning – process by which experience produces a relatively enduring change in an organism’s behaviour or capabilities Adapting to the Environment Behaviourists focus on how organisms learn, examining the processes by which the experience influences behaviour Ethology focuses on the functions of behaviour Adaptive significance – how behaviour influences an organism’s chances for survival Fixed - [Memory: Storing & Accessing Information](https://schoolworkhelper.net/memory-storing-accessing-information/) - Memory – processes that allow us to record and later retrieve experiences and information Memory as Information Processing Encoding – getting information into the system by translating into a neural code that your brain processes Storage – retaining information over time Retrieval – the process of accessing information in long term memory Three-Component Model Three - [Language: History and Structure](https://schoolworkhelper.net/language-history-and-structure/) - Language: History and Structure Language – a system of symbols and rules for combining these symbols in ways that can produce an almost infinite number of possible messages and meanings Three critical properties of language: Symbolic: Uses sounds, written signs, or gestures to refer to objects, events, ideas, and feelings Displacement – capacity of language - [Types of Reasoning & Stages of Problem Solving](https://schoolworkhelper.net/types-of-reasoning-stages-of-problem-solving/) - Two types of reasoning: Deductive reasoning – reasoning from a general principle to a specific case Basis of formal mathematics and logic Viewed as stronger and more valid reasoning because conclusion cannot be false if premises are true Syllogism: If all humans are mortal (first premise), and Socrates is a human (second premise), then Socrates - [Hunger & Weight Regulation: The Physiology of Hunger](https://schoolworkhelper.net/hunger-weight-regulation-the-physiology-of-hunger/) - Metabolism – body’s rate of energy utilization Two-thirds of energy used goes to support basal metabolism, the resting, continuous metabolic work of body cells Immediate energy supply information interacts with other signals to regulate food intake (hunger not necessarily linked to immediate energy needs) Homeostatic mechanisms are designed to prevent people from running low on - [Types of Motivation and Emotion](https://schoolworkhelper.net/types-of-motivation-and-emotion/) - Motivation – process that influences the direction, persistence, and vigour of goal directed behaviour Perspectives on Motivation Instinct Theory and Modern Evolutionary Psychology Instinct (fixed action pattern) – an inherited characteristic, common to all members of a species, that automatically produces a particular response when the organism is exposed to a particular stimulus Theories faded - [Sexual Motivation: The Physiology of Sex](https://schoolworkhelper.net/sexual-motivation-the-physiology-of-sex/) - Sexual response cycle – four stage cycle experienced during sexual arousal Excitement phase – arousal builds rapidly Plateau phase – respiration, heart rate, vasocongestion, and muscle tension continue to build until there is enough muscle tension to trigger orgasm Orgasm phase – males: rhythmic contractions of internal organs and muscle tissue surrounding the urethra project - [Cell Cycles: Interphase, Mitosis, Cytokinesis](https://schoolworkhelper.net/cell-cycles-interphase-mitosis-cytokinesis/) - Cell Cycle: nuclear division, cytokinesis Parental cell: genetic copies of parental cell 3 process: checks/ regulators for each step to ensure timely progression, replication process to synthesis DNA into two copies, interwoven “cables” and “motors” of mitotic cytoskeletons. Chromosomes: nuclear units of genetic information; DNA molecules combined with proteins. In eukaryotes, heredity information of nucleus - [Prokaryotic: F factor, Transformation, Transduction](https://schoolworkhelper.net/prokaryotic-f-factor-transformation-transduction/) - Genetic recombination needs: Homologous chromosomes; must differ from one another along one at least two spots Mechanism to bring into close proximity of each other Homology allows the DNA to line and recombine precisely. Cut and passing 4 DNA backbones results in 1 recombination event. Lederberg Experiment E.coli grown in minimal medium; contains water, organic - [Mendel and Genetics](https://schoolworkhelper.net/mendel-and-genetics/) - Blending theory of inheritance: hereditary trait blend evenly in offspring through mixing of parent’s blood. Mendel studied heritable characteristics called characters; plant color and seed shape. Variation in character= Trait Monohybrid cross between to heterozygous parents (Dr x Dr) F1 generation will yield phenotypic ration of 3:1 (1/4 getting PP or pp, or ½ getting - [Genetic Linkage and Recombination](https://schoolworkhelper.net/genetic-linkage-and-recombination/) - Genetic linkage: genes located on the same chromosome may be inherited together in genetic crosses.Linked Genes: Genes on the same chromosomesMorgan- first to map genes; can’t directly measure the distance between genesDo it indirectly- genes sitting far apart on a chromosome would be more likely to be separated from one another during meiotic crossing-over than - [Genetic Recombination in Eukaryotes: Meiosis](https://schoolworkhelper.net/genetic-recombination-in-eukaryotes-meiosis/) - Sexual reproduction: production of offspring; union of male and female gametes Gametes: eggs and sperms cells in animals Sexual reproduction depends on Meiosis; specialized process of cell division; recombines DNA sequences, produces cells with half the number of chromosomes in somatic cells. (chromosome= reduction) Fertilization: nuclei of egg/ sperm fuse; producing zygote (# chromosomes typical - [Macbeth Summary: Act III, Scenes i, ii, iii](https://schoolworkhelper.net/macbeth-summary-commentary-of-act-iii-scene-iiiiii/) - The first scene starts with Banquo voicing his suspicions about Macbeth killing Duncan in order to become the King. He is aware that the witches had prophesized that his sons would become Kings. But he doesn't let this thought obsess him. He is capable of controlling his thoughts and checking his ambitions unlike Macbeth which - [Significance of Social Order Essay](https://schoolworkhelper.net/significance-of-social-order-essay/) - Humans as a race have come a long way since our introduction to earth. Today, our world is defined by systematic approaches and specific methods of living. The poem “Sophoclean” by Seamus Heaney touches on some of the historical characteristics of humanity and highlights the elements of our success as a species. A Marxist analysis - [Summary of Ralph Ellison's Invisible Man](https://schoolworkhelper.net/summary-of-ralph-ellisons-invisible-man/) - Ralph Ellison's Invisible Man opens with a prologue describing the main character in time after the beginning of the body of the book. In the prologue, Ellison tells of the main character’s invisibility. It is not a physical invisibility, but rather he is not recognized, and therefore perceived, by the world at large. This is - [How Ralph is Shown as a Good Leader in the Novel Lord of the Flies](https://schoolworkhelper.net/how-ralph-is-shown-as-a-good-leader-in-the-novel-lord-of-the-flies/) - What qualities make someone a good leader? In Lord of the Flies who demonstrates this role of being a leader, and how is it being displayed? A leader is someone who has the ability to take control and charge of a group. A leader is there to guide, manage, and provide assistance to a group - [King Lear Summary](https://schoolworkhelper.net/king-lear-summary/) - Lear, the aging king of Britain, decides to step down from the throne and divide his kingdom evenly among his three daughters. First, however, he puts his daughters through a test, asking each to tell him how much she loves him. Goneril and Regan, Lear's older daughters, give their father flattering answers. But Cordelia, Lear's - [The Milky Way Galaxy](https://schoolworkhelper.net/the-milky-way-galaxy/) - Formation: Differences between disk and halo: –Orbits of stars, ages of stars, the metal contents in stars, and the amount of gas and dust are all different Current theory suggests that the Galaxy formed from an enormous cloud of gas (the Protogalactic Cloud) The halo and the first generations of stars formed as this cloud - [Stars and Their Life Cycles: Hertzsprung-Russell](https://schoolworkhelper.net/stars-and-their-life-cycles-hertzsprung-russell/) - The evolution of the star: Stars are born out of clouds of gas and dust. A star generates energy by converting hydrogen into helium deep in the centre (the core). As most of the hydrogen turns into helium in the core, the core runs out of “fuel”. The core contracts under pressure and becomes hotter - [Earth and Space Definitions](https://schoolworkhelper.net/earth-and-space-definitions/) - Star: A large ball of glowing gas that generates heat and light, through nuclear fission in its cove. Our sun is a star. Planet: any of the nine large celestial bodies in the solar system that revolves around the sun and shine by reflected light. Moon (or satellite): the natural satellite of the Earth. - [Relative Sizes and Distances in our Universe](https://schoolworkhelper.net/relative-sizes-and-distances-in-our-universe/) - Relative Sizes (Earth, solar system, Milky Way galaxy, local super cluster, universe) Relative Distances If the sun shrank to 1mm (grain of sand) then earth would be 11cm away, Pluto would be 4 meters and the nearest star would be ajaxIf the entire solar system shrank to 1mm one side of the milky way would - [Great Gatsby Essay: The Pursuit of the American Dream](https://schoolworkhelper.net/great-gatsby-essay-the-pursuit-of-the-american-dream/) - A major theme in The Great Gatsby is the pursuit of what can be termed the American dream. Do you agree? By choosing a major character or a situation in Fitzgerald’s novel, discuss how or whether Fitzgerald is successful in exposing the underside of the American dream) This represents the idea of the American Dream, - [The Lead- Acid Car Battery](https://schoolworkhelper.net/the-lead-acid-car-battery/) - Lead-Acid batteries were the first type of rechargeable battery ever invented. They were invented in 1859 by the French physicist, Gaston Plante. They are very useful in vehicles due to their low cost, robust nature, high tolerance for abuse and large power-to-weight ratio. lead-acid batteries are not only used in cars, but can be used - [Macbeth Essay: Guilt & Crimes](https://schoolworkhelper.net/macbeth-essay-guilt-crimes/) - In Shakespeare’s play Macbeth, the theme of guilt is established through Lady Macbeth, blood imagery and Macbeth’s internal conflict. - [Types and Arguments of Euthanasia](https://schoolworkhelper.net/types-and-arguments-of-euthanasia/) - Margret Sumerville defines Euthanasia- Euthanasia is a deliberate act that causes death undertaken by one person with the primary intention of ending the life of another person, in order to relieve that persons suffering. Three types of Euthanasia: Voluntary : -a person asks that his or her life be terminated as an act of mercy. - [Objective Point of View & Allegory](https://schoolworkhelper.net/objective-point-of-view-allegory/) - narrator disappears into a kind of roving sound camera imposes severe limitations on the author the author is not there to explain purest example would be one written entirely in dialogue Allegory a type of narrative in which the surface story reflects at least one other meaning traditional allegory frequently employs personification (human characters to - [Freud- Century of the Self Video Analysis](https://schoolworkhelper.net/freud-century-of-the-self-video-anaylsis/) - According to Freud, in human nature there are sexual and aggressive forces hidden in the minds of all human beings—forces that if not controlled, lead society to chaos and destructionToday, a theory used to control mass crowd in world of mass democracyEdward Bernais- first person to use Freud’s ideas to manipulate massesShowed corporations how they - [Vocabulary in Pride and Prejudice](https://schoolworkhelper.net/vocabulary-in-pride-and-prejudice/) - Chapters 1 – 21 Abode – dwelling place Affability – friendliness; courtesy Amends – give compensation Assent – agree; consent; approve Bestow – confer as gift Caprice – whim; lively or fanciful work of music, etc. Censure – criticise harshly; reprove Civility – politeness; act of politeness Condescend – graciously consent to do something while - [Determining Ksp of Calcium Hydroxide Through Titration Lab](https://schoolworkhelper.net/determining-ksp-of-calcium-hydroxide-through-titration/) - Introduction Aqueous calcium hydroxide, also known as lime water is used to verify the presence of carbon dioxide gas, (carbon dioxide reacts with the calcium hydroxide to produce calcium carbonate) this is achieved by bubbling the gas through the solution, if the solution turns cloudy then the precipitate calcium carbonate has formed, thus carbon dioxide - [Slavery in Ancient Greece](https://schoolworkhelper.net/slavery-in-ancient-greece/) - Ancient writers were aristocrats, they didn’t know what it was like to be a slave, to be a Sometimes masters would breed slaves If someone who was freed, had children with another non-citizen, the children were free but had limited rights, not citizens Sources – worthless because masters always shown the slave as goofing off - [Hesiod, and Greek Religion and Myth](https://schoolworkhelper.net/hesiod-and-greek-religion-and-myth/) - The Olympians The Polytheism (belief in more than one God) found in poems of Homer stayed a permanent belief throughout Greece until the Christian era There are twelve principal gods and goddesses (deities), headed by Zeus and the rest are his siblings, his children, and grandchildren, it is only Dinoysus that Homer doesn’t acknowledge Zeus - [The Cold War](https://schoolworkhelper.net/cold-war-essay/) - Subsequent to the nuclear attacks on Hiroshima & Nagasaki in August of 1945, WWII finally came to an end. Along with the death of “The war to end all wars,” came an ideological battle that started a stagnant nuclear war which had the potential to eliminate mankind. Following the over-glorified allied victory of WWII, two - [Heavy Metal Lab Answers: S. cerevisiae & R. rubra](https://schoolworkhelper.net/heavy-metal-lab-answers-s-cerevisiae-r-rubra/) - Introduction Despite being naturally occurring, the amount of heavy metals in the environment has increased greatly throughout the years as a result of industrialization and human activity. Although many of these metals are vital for sustaining the lives of various microorganisms, high levels have resulted in much pollution and the disruption of the biotic processes - [Estate Law Summary: Inheritance](https://schoolworkhelper.net/estate-law-summary-inheritance/) - Death, of course, has major implications for families. When a person dies all their assets transfer to the heirs. Under our law there are two ways for this to happen: By a will – a written expression of the person’s intention for his/her property; or By operation of law where no will exists. Wills (provincial - [Contract Law: Process, Components, Methods](https://schoolworkhelper.net/contract-law-process-components-methods/) - The Importance of Contracts Everyday, consciously or unconsciously, you enter into a number of contracts. In fact, without contracts our modern world would quickly grind to a halt. What is a contract? A contract is simply an agreement or promise between two or more parties (people, partnerships, companies or governments) that the law will enforce. - [Summary of Greek Play: Antigone by Sophocles](https://schoolworkhelper.net/summary-of-greek-play-antigone-by-sophocles/) - The Greek playwrite, Sophocles, wrote many exceptional plays. One of these is Antigone. The play is named after Oedipus's daughter, although it is primarily about her Uncle Creon. Creon is the focal point and it is his misjudgment and pride that causes his downfall. Yet, the title of this story is still Antigone. This is - [The Significance of Film Form](https://schoolworkhelper.net/the-significance-of-film-form/) - Form in Film Artwork cues us to perform a specific activity. Without playing along and picking up on the cues, the artwork remains only an artifact. (A painting uses color, lines, and other techniques to invite us to imagine the space portrayed or to run our eye over the composition in a certain direction.)In any - [Narrative as a Formal System](https://schoolworkhelper.net/narrative-as-a-formal-system/) - Principles of Narrative Construction Narrative film – a film that tells a story What is Narrative? We can consider narrative to be a chain of events linked by cause and effect and occurring in time and space. Typically begins with one situation; a series of changes occurs according to a pattern of cause and effect; - [The Napoleonic Settlement and the Napoleonic Empire](https://schoolworkhelper.net/the-napoleonic-settlement-and-the-napoleonic-empire/) - The ‘Brumaire Coup’ I)The Consulate I. 25 December 1799 Constitution: Napoleon Bonaparte as First Consul A. The constitution was approved in the Dec 1799 plebiscite B.1802- Napoleon becomes “consul for life” C. 2 Dec 1804- Crowned ‘Emperor of France” II) The Napoleonic Years A Firm Rule Centralism and Growth of Powers by the State Reconciliation - [Aeschylus’ Libation Bearers Essay](https://schoolworkhelper.net/aeschylus-libation-bearers-essay/) - In Aeschylus’ play The Libation Bearers the motivations of Electra and Orestes are formed out of a responsibility to honour their father, and uphold their promises to the gods out of a fear of possible punishment. In this essay I plan to evaluate how the environment in which a person is born can affect their - [Television and Its Effects on Interfamilial Relationships](https://schoolworkhelper.net/television-and-its-effects-on-interfamilial-relationships/) - Since its invention, television has enjoyed an increasingly prominent presence in the homes of western families. In fact, as of 2000, the vast majority (98%) of American households owned at least one television set (Wilson 2004). Though it is indisputable that this overwhelming proliferation of television does not come without consequences for the family unit, - [Citizenship Essay: Fundamentals Towards the Future](https://schoolworkhelper.net/citizenship-essay-fundamentals-towards-the-future/) - “Citizens are made not born”[1]. This statement is the basis on which citizenship is defied because it takes into account that citizenship is more than just being born into a country, it encompasses the notion that citizenship can be changed, is active and can be taught. In order for a democratic society to function properly, - [Types of Mental Illness: Psychoses, Neuroses, Defence mechanisms](https://schoolworkhelper.net/types-of-mental-illness-psychoses-neuroses-defence-mechanisms/) - With ¼ North Americans being affected with a mental illness sometime in their life, people can see that living in a family with one member affected by a mental illness is quite prevalent. From this lone statistic, one would think that much of our countries population would be educated on the topic of mental illnesses; - [Chromatography Lab Answers](https://schoolworkhelper.net/chromatography-lab-answers/) - Purpose The purpose of the experiment is to determine the specific types of pigments found in a beet leaf and in a spinach leaf by using paper chromatography and two solvents: water soluble solvent and lipid soluble solvent. Hypothesis If a water soluble solvent is present, then there will be the movement of only the - [“Romeo and Juliet”: An Archetypal Analysis of Juliet](https://schoolworkhelper.net/romeo-and-juliet-an-archetypal-analysis-of-juliet/) - Very often, traumatic events in a person’s life can stay with them for significant amounts of time after the event is over. Juliet, by Helen Fogwill Porter, tells the story of a woman burdened by the troubles of her past. Juliet cannot seem to escape certain memories of her child. Throughout the story, these memories - [A Declaration of Grievances; Louis XVI’s Downfall](https://schoolworkhelper.net/a-declaration-of-grievances-louis-xvis-downfall/) - In pre-revolutionary France, the monarchy was more than a core component of the French identity – indeed for many, it was the French identity. A king had always ruled, and the nation held a sense of pride and a vested interest in upholding a throne that had endured centuries of turbulence and had emerged relatively - [Fallacies About Crime](https://schoolworkhelper.net/fallacies-about-crime/) - The dramatic fallacy: offenses in the media that are publicized are far more dramatic than those commonly found in real life= ex: shoot out, romantic murder The cops-and-courts fallacy: warns us against overrating the latter, except as a responsive set of agencies: ex: few convictions based on trials they are plea-bargained The not me fallacy: - [James Joyce’s “The Dead” Essay: Ireland’s Frozen State of Mind](https://schoolworkhelper.net/james-joyces-the-dead-essay-irelands-frozen-state-of-mind/) - In James Joyce’s “The Dead,” every scene contributes to what Andrew E. Cox in Modern Literature: An Introduction and Survey describes as “the themes and patterns of the work as a whole” (8). This is especially prevalent when the protagonist, Gabriel Conroy, gives a speech during dinner in the presence of family and friends at - [Gerald Friesen: Citizens and Nation Essay](https://schoolworkhelper.net/gerald-friesen-citizens-and-nation-essay/) - In Citizens and Nation, Gerald Friesen, suggests a structure for understanding Canadian history based upon four epochs, each centered upon a principle communication medium. According to Friesen, Canada is a story of communication that changes from the “oral-traditional” world of pre-contact Aboriginal people to the “textual-settler” household of immigrants and finally to the “print-capitalism” of - [“Hymn to God My God, in My Sickness” Analysis Essay- John Donne](https://schoolworkhelper.net/hymn-to-god-my-god-in-my-sickness-analysis-essay-john-donne/) - John Donne’s poem, “Hymn to God My God, in My Sickness” is a religious poem where the speaker is on his death bed. The speaker believes that as the sun rises and sets, death and resurrection are linked together; and therefore, one should not be scared of dying. The speaker of the poem believes that - [Biography of George Lucas](https://schoolworkhelper.net/biography-of-george-lucas/) - George Lucas is one of the most influential film makers in Hollywood history. He is also the guiding force behind Star Wars and its sequels. The Star Wars movies tell the story of the rebels Luke Skywalker, Princess Leia, and Han Solo as they battle the evil imperial forces of Darth Vader. These films became - [Sharks: Families, Fossil, Shape](https://schoolworkhelper.net/sharks-families-fossil-shape/) - SHARK FAMILIES: There are more than 350 know species of sharks today, which can all be placed under 8 scientific orders that contain 30 families. They are placed into these categories by their shared characteristics, this is called taxonomy. The more closely related species are placed in another family in the order. SQUAINIFORMES: The angel - [England’s Queen Elizabeth Biography](https://schoolworkhelper.net/englands-queen-elizabeth-biography/) - Countess of Longford, Elizabeth Pakenham, was born in London England in 1906. She attended Lady Margaret Hall and Oxford University where she studied classical history and philosophy. She later married Oxford professor and politician, the seventh Earl of Longford in 1931, with whom she had eight children. She worked as a tutor from 1930-36 in - [NATO and combating terrorism](https://schoolworkhelper.net/nato-and-combating-terrorism/) - Terrorism is a predominant issue on the agendas of global leader’s in the 21st century. The US and its allies consider terrorism as a top priority, primarily due to the 9/11 attacks on the US. The North Atlantic Treaty Organization (NATO) consists of the US, Canada, and 23 other European allies. Defence against terrorism became - [American Buffalo: Summary, Analysis, Theme, Characters, Setting- David Mamet](https://schoolworkhelper.net/american-buffalo-summary-anaylsis-theme-characters-setting-david-mamet/) - Setting: The entirety of Mamet’s play is set inside Don’s resale shop. The play begins in the junk shop midmorning. All of the play’s dialogue occurs within the shop, while almost every piece of action (be it getting coffee etc) occurs outside of the shop. The shop serves as the center of the characters’ plan - [What Makes an Effective Poster? Tips and Tricks](https://schoolworkhelper.net/what-makes-an-effective-poster-tips-and-tricks/) - The Basics Effective posters have three traits: The information is written clearly and concisely.The information is presented in a way that places the meaning of the text ahead of the style that it is presented in.The poster is displayed in areas that are highly visible. Readability: Writing Clearly and Concisely Readability is a function of - [Gladiators: Origins, Armour, Fights, Techniques](https://schoolworkhelper.net/gladiators-origins-armour-fights-techniques/) - Coliseum; amphitheatre Invented architecture primarily for these combats Amphi- going all the way around; the theatre in the round Coliseum- colossal Performance space with people sitting all around is a Roman invention Arena= sand (that’s what you needed to soak up the blood) 45m x 20m (performance space) 200x 150m 9 storeys tall Equipped with - [Fall of the Roman Republic: Caesar & Mark Antony](https://schoolworkhelper.net/fall-of-the-roman-republic-caesar-mark-antony/) - Mark Antony: Co-Consul With Caesar Assassins killed Caesar and said the republic was restored Mark Antony said well I’m in charge He was Caesar’s best friend- Brutus refused (we’re not butchers, were getting rid of a tyrant; we’re not killing all of our opponents) MA was now in charge No one knew what was going - [Roman Chariot Racing & Athletics](https://schoolworkhelper.net/roman-chariot-racing-athletics/) - Outstripped any other kind of public entertainment Bread and circuses Chariot races were held in the circus (circuit) The Circus Maximus- largest in Rome, one of the oldest Rudimentary seating all around the race track but it kept getting renovated until it became the largest building in the Roman empire 600 m x 150 m; - [Autism and the Environment](https://schoolworkhelper.net/autism-and-the-environment/) - Autism, a growing social disorder in our society is defined as a pervasive developmental disorder of children, characterized by impaired communication, excessive rigidity, and emotional detachment. Over the years autism has remained a mystery when it comes to the cause. The original theory was that autism was caused by genetic predisposition, but over time this - [Al-Qaeda: History, Terrorism, Bin Laden](https://schoolworkhelper.net/al-qaeda-history-terrorism-bin-laden/) - Al-Qaeda, an Arabic word for “the base” was a terrorist group started in 1988 by a wealthy Saudi named Osama Bin Laden. The members of Al-Qaeda believe an extremist form of Islam known as Wahhabi. This is one of the most traditional forms of Islam which teaches that the only respectable word is that of - [Ghost in Hamlet Commentary Analysis](https://schoolworkhelper.net/ghost-in-hamlet-commentary-analysis/) - Ghost Ay, that incestuous, that adulterate beast,With witchcraft of his wit, with traitorous gifts,--O wicked wit and gifts, that have the powerSo to seduce!--won to his shameful lustThe will of my most seeming-virtuous queen:O Hamlet, what a falling-off was there!From me, whose love was of that dignityThat it went hand in hand even with the - [Landlord and tenant law](https://schoolworkhelper.net/landlord-and-tenant-law/) - Landlord and tenant law has a lengthy history which can have its origins traced all the way back to the Code of Hammurabi. However, landlord and tenant law evolved into its present shape during the Middle Ages in England. A landlord is defined as a person or group which owns property and agrees to allow - [Health Science: Key Terms](https://schoolworkhelper.net/health-science-key-terms/) - Health – the overall condition of the body or mind and the presence or absence of illness or injury Wellness – optimal health and vitality, encompassing all the dimensions of well-being Risk Factor – a condition that increases ones chances of disease or injury Infectious Disease – a disease that can spread from person to - [The Julio-Claudians: Tiberius, Gaius, Nero](https://schoolworkhelper.net/the-julio-claudians-tiberius-gaius-nero/) - The Julio-Claudians Emperors: Civil Government and Military Concerns Relations between emperor and subjects encompassed dealings with the senators and equites Augustus portrayed himself first among equals rather than as dictator like Julius Caesar, thus emphasizing civil rather than military power Augustus’ immediate successors came from his extended family so a single dynasty ran the Roman - [The Bendy Meter Stick Lab: Hooke’s Law Answers](https://schoolworkhelper.net/the-bendy-meter-stick-lab-hookes-law-answers/) - Purpose The purpose of this experiment is to determine the relationship between the vertical depression of the free end of a meter stick and the weight sticks attached. Theory Hooke’s Law shows that when an elastic material is deformed, restoring forces will arise which try to bring the material back to its starting situation. The - [Battle of Vimy Ridge: Analysis & Significance](https://schoolworkhelper.net/battle-of-vimy-ridge-analysis-significance/) - The battle of Vimy Ridge was one of the major, and most critical, battles of World War I. Vimy Ridge was a 475-meter tall fortification, which had an unobstructed view for several kilometers (Vimy Ridge- Radessays). The ridge was located near the French town of Arras. The first battles at the ridge took place between - [The Effect of Contact on Aboriginals](https://schoolworkhelper.net/the-effect-of-contact-on-aboriginals/) - During contact with the Europeans, Aboriginals suffered many major setbacks. Many of these problems were due to the fact that Europeans had introduced new elements to their society, which they either could not handle physically or culturally. The most lethal introduction into Aboriginal society was diseases. Over time, people in Europe had built up immunities - [Shakespearean & Elizabethan Medicine and Doctors](https://schoolworkhelper.net/shakespearean-elizabethan-medicine-and-doctors/) - Doctors in Shakespeare’s time were not very educated compared to today’s doctors. Most of their work was based on the philosophies of Aristotle and Hippocrates. The beliefs that the doctors shared were accepted by most people during the Shakespearean era. There were some doctors that did not agree with Hippocrates and Aristotle. They believed that - [Exploring the Renaissance](https://schoolworkhelper.net/exploring-the-renaissance/) - Art Over the course of the Renaissance, a large range of art was crafted. This art depicted many different perspectives and ideas. Different forms of colour, light, imagery and realism were used to convey the artist’s message. During the Renaissance, art began to evolve in terms of style as well as content. One of the - [The Rationality Behind the Soviet Buffer Zone](https://schoolworkhelper.net/the-rationality-behind-a-soviet-buffer-zone/) - As World War II drew to a close the political geographic makeup of Europe began to shift drastically. After Germany had invaded Russia in 1941 as part of Operation Barbarossa, the tide of the war began to shift. After the German invasion was halted, the USSR began to push the enemy back, and in 1945 - [Brave New World Analysis: Chapter 1-6](https://schoolworkhelper.net/brave-new-world-analysis-chapter-1-6/) - Brave New World by Aldous Huxley is a really unique and interesting novel. Right from the start, I felt that Huxley used satire as an effective literary tool. In the first chapter Huxley makes a very bold statement. As the world is getting excited about the march of science, Huxley shows that this could very - [Brave New World Analysis: Chapter 13-17](https://schoolworkhelper.net/brave-new-world-analysis-chapter-13-17/) - The end of Brave New World contained a lot of exciting components. In Chapter 13 Lenina remains confused by how she might be in love with one man. She is finally ready to sleep with John. After taking soma, she goes to seduce John, and John talks about how he wants to grow old with - [Honduras: History, Politics, Coup d’état](https://schoolworkhelper.net/honduras-history-politics-coup-detat/) - Honduras is a tiny nation in Central America, known for its violent history and consistent political instability. Honduras borders many nations, including Guatemala, Nicaragua, and El Salvador. Along with land borders, Honduras is also bordered by the Pacific Ocean, the Gulf of Fonseca and the Gulf of Honduras. Honduras is small in physical stature compared - [Law of Conservation of Momentum Lab Answers](https://schoolworkhelper.net/law-of-conservation-of-momentum-lab-answers/) - Theory The Law of Conservation of Momentum states that in a closed system, the total momentum of masses before and after their collision is constant-momentum, which is conserved. This states that when two things collide the sum of the momentum will be the same before the collision as after. This law also states that the - [Freedom of Speech Analysis and Significance](https://schoolworkhelper.net/freedom-of-speech-analysis-and-significance/) - Imagine a life where you had no freedom to speak what was on your mind, and imagine what it would be like to live in a world like this. Noam Chomsky, a linguistics professor at the Massachusetts Institute of Technology is a big supporter with the idea of free speech. He is known across the - [Substance Abuse: Drugs and Alcohol Effects](https://schoolworkhelper.net/substance-abuse-drugs-and-alcohol-effects/) - Factors affecting the absorption of alcohol Body weight – greater volume of blood in a larger person keeps the blood alcohol level lower Speed of drinking – faster alcohol is consumed the quicker the blood alcohol will rise Food in stomach – food absorbs the alcohol in your body Mix of drinks – alcohol and - [Labour Force: Income Security & Insurance](https://schoolworkhelper.net/labour-force-income-security-insurance/) - Income Support System · Employment Insurance (EI) · provides a level of income replacement to those workers who are temporarily out of work and meet strict eligibility conditions · Social Assistance (SA) · provides minimal income support to those who do not qualify for Employment Insurance Key Concepts · Employment: any legal activity carried out - [Bonding Capacity: Rules & Exceptions](https://schoolworkhelper.net/bonding-capacity-rules-exceptions/) - - Bonding capacity is an important chemical property for elements - All members of the Alkali Metals have one extra electron and need to give it away - Alkaline Earth Metals have two extra electrons that they must get rid of - Halogens need to acquire an electron along with chalcogens - Alkaline Earth will - [Cardiovascular System: Structure & Function](https://schoolworkhelper.net/cardiovascular-system-structure-function/) - The cardiovascular system or circulatory system is a system that moves nutrients, gases, and wastes between cells helps fight diseases and transports blood throughout the body (Circulatory System). The main components of the human cardiovascular system include the heart, blood, and various blood vessels. There are several different circuits contained in the cardiovascular system. One - [Marketing mix & Marketing fundamentals](https://schoolworkhelper.net/marketing-mix-marketing-fundamentals/) - The essence of marketing: - Focusing on customer needs - Creating customer value (Achieved by delivering outstanding value through the combination of (1) pricing strategies, (2) product design, and (3) service elements. - Appealing to target markets - Coordinating the marketing mix Customer value: The unique combination of benefits received by targeted buyers that includes - [The Marketing Environment: Competitive Forces](https://schoolworkhelper.net/the-marketing-environment-competitive-forces/) - The marketing environmental scan: The process of continually acquiring information on events occurring outside the organization to identify trends, opportunities, and threats to your business. 6 forces marketers look at: Demographic forces: The statistical data on a population according to characteristics such as age, gender, ethnicity, income and occupation.Socio-cultural forces: Cultural values, ideas, and attitudes, - [Consumer Behavior & Psychological Influences](https://schoolworkhelper.net/consumer-behavior-psychological-influences/) - Consumer behavior: Actions a person takes when purchasing and using products and services. Consumer purchase decision process: Stages that a buyer passes through when making choices about which products or services to buy. Stages: Problem recognition: perceiving a need: This is when a person realizes that the difference between what he or she has and - [Marketing: Values, Beliefs and Attitudes](https://schoolworkhelper.net/marketing-values-beliefs-and-attitudes/) - Learning: Behavioral learning: The process of developing automatic responses to a type of situation built up through repeated exposure to it. Marketers use: Stimulus generalization: Using the same brand name to launch new products is a common application. Stimulus discrimination: Ability to perceive differences among similar products. Cognitive learning: Involves making connections between two or - [Market research & development](https://schoolworkhelper.net/market-research-development/) - Marketing information system (MIS): A set of procedures and processes for collecting, sorting, analyzing, and summarizing information on an ongoing basis. Market research: The process of collecting and analyzing information in order to recommend actions to improve marketing activities. Research classifications: Exploratory research: Preliminary research conducted to clarify the scope and nature of the marketing - [Market Segmentation & Targeting](https://schoolworkhelper.net/market-segmentation-targeting/) - Market segmentation: The aggregation of prospective buyers into groups that have common needs and respond similarly to marketing programs. 2 main market segments: - Consumer market: Consists of products, ideas, and services that a person can purchase for personal use - Business market: Products that are purchased either to run a business or to be - [Marketing: Products and Brands](https://schoolworkhelper.net/marketing-products-and-brands/) - Types of products: Product: A good, a service, or an idea consisting of tangible and intangible features. Non-durable goods: An item that does not last and is consumed only once, or for a limited number of times. (Food and fuel) Durable good: A product that lasts for an extended period of time and encompasses items - [Marketing: Distribution and Supply Chain](https://schoolworkhelper.net/marketing-distribution-and-supply-chain/) - Nature and importance of marketing channels: Marketing channel: the set of individuals or firms involved in the process of making a product available. Intermediaries: Individuals or firms performing a role in the marketing channel, involved in making a product available. Functions performed by intermediaries: - Transactional function: This is done when they buy and sell - [Marketing: Customer Relationship Management](https://schoolworkhelper.net/marketing-customer-relationship-management/) - Customer relationship management (CRM): The overall process of building and maintaining profitable customer relationships by delivering superior customer value and satisfaction. (Software that keeps your files, banking systems have all your information stored). The software can be assessed from wherever because its on the companies server. CRM entails cultural changes: CRM is an overall company - [Parable of the Good Samaritan: Gospel of Luke Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-good-samaritan-gospel-of-luke-analysis-explanation/) - The Good Samaritan is the story of a man who was robbed and beaten and left for dead. While he is lying there clinging to life, he is passed by several people of the prominent ethnic groups and communities who choose not to help him. Finally, a Samaritan who is not as prominent and has - [Parable of the Wise and Foolish Builders: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-wise-and-foolish-builders-gospel-of-matthew-analysis-explanation/) - The parable of the wise and foolish builders is a parable told by Jesus telling people to listen to his advice. Jesus takes the man who built his house on the rock as an example. In extreme conditions the man whose house was built on a rock survived through the storm. The foolish builder built - [Parable of the Unjust Judge: Gospel of Luke Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-unjust-judge-gospel-of-luke-analysis-explanation/) - The parable of the unjust judge is a parable told by Jesus about a judge who did not fear God, nor care for his fellow man. He is approached by a lady, who asks him to grant her justice. The judge decides to grant her justice so that she will stop bothering him. God accepts - [Parable of Drawing in the Net: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/parable-of-drawing-in-the-net-gospel-of-matthew-analysis-explanation/) - The parable of drawing in the net is a story told by Jesus about a fisherman who catches many fish from the lake. He keeps the ones which he likes and he throws away the ones which are bad. The significance of this story to me is the judgment theme. The fisherman in this parable - [The Parable of the Two Sons: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/the-parable-of-the-two-sons-gospel-of-matthew-analysis-explanation/) - The parable of the two sons is about a father who tells his first son to go work in the vineyard. The son says he does not want to, but he winds up working on it anyway. When the father tells his second son to go work on the vineyard, he tells him he will - [Parable of the Lost Coin: Gospel of Luke Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-lost-coin-gospel-of-luke-analysis-explanation/) - The parable of the lost coin is the story of a woman who loses one of her ten silver coins. She looks through her entire house and rejoices when she finds the coin. After finding this coin, the lady makes it seem like one coin has become more valuable than all of the other nine - [Parable of the Ten Virgins: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-ten-virgins-gospel-of-matthew-analysis-explanation/) - The parable of the ten virgins is a story about ten virgins who are awaiting a bridegroom’s arrival. There are five virgins who are prepared for the arrival and they await him with a jar of oil. The five virgins who are not prepared do not have a jar of oil and leave to go - [Parable of the Unmerciful Servant: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-unmerciful-servant-gospel-of-matthew-analysis-explanation/) - The parable of the unmerciful servant is about a servant whose master ordered him to pay back 10 000 talents of money. The servant could not pay the money and asked his master for mercy. The master told him he did not have to pay off the debt. Then another servant who owed the servant, - [Parable of the Prodigal Son: Gospel of Luke Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-prodigal-son-gospel-of-luke-analysis-explanation/) - The parable of the prodigal son is about a young man who demands his father’s inheritance while he is still living. He takes the money and foolishly squanders it. He comes back and repents to his father and is taken in with open arms. Meanwhile, the father has a second son, who becomes jealous of - [Parable of the Workers in the Vineyard: Gospel of Matthew Analysis & Explanation](https://schoolworkhelper.net/parable-of-the-workers-in-the-vineyard-gospel-of-matthew-analysis-explanation/) - The parable of the workers in the vineyard is about several workers who are hired by a man who owns a vineyard, over different periods of time. At the end of the day the people who are hired first expect to be paid more than those hired later. But, the man pays all of the - [Charles Law: Volume & Temperature Lab Answers](https://schoolworkhelper.net/charles-law-volume-temperature-lab-answers/) - Observations Analysis When measuring the volume of air in the flask at the first temperature, a volume of 250 mL was recorded, known as V1. The temperature of the air in the flask in boiling water was recorded as 99ᵒC, known as T2. In order to find the correct calculations, 99ᵒC has to be converted - [Central Dogma of Biology](https://schoolworkhelper.net/central-dogma-of-biology/) - The term “dogma” describes a doctrine or code of beliefs accepted as authoritative. The central dogma of biology refers to the way that genetic information is stored and retrieved in living cells. The classic relationship is DNA > RNA > Protein. Thus DNA functions as the information storage molecule, and this information is "read out" - [Amino Acids: Categories & Function](https://schoolworkhelper.net/amino-acids-categories-function/) - More properly known as alpha-amino acids, their general structure is: Nineteen of the twenty amino acids have the same arrangement around the central alpha-carbon: a. an amino group, b. a carboxyl group, c. a hydrogen, and d. an R group (called the "side chain") which differs for each amino acid. Recall that when 4 different - [Protein Structures: Primary, Secondary, Tertiary, Quaternary](https://schoolworkhelper.net/protein-structures-primary-secondary-tertiary-quaternary/) - Proteins are the largest and most varied class of biological molecules, and they show the greatest variety of structures. Many have intricate three-dimensional folding patterns that result in a compact form, but others do not fold up at all ("natively unstructured proteins") and exist in random conformations. The function of proteins depends on their structure, - [Protein Purification](https://schoolworkhelper.net/protein-purification/) - It is often necessary to obtain a preparation containing protein molecules of only a single type (a “pure protein”); eg. for medical use or scientific study. With such preparations, one may determine 3D structure, binding affinities, or determine the amino acid sequence. Obtaining a pure protein is generally challenging because there are thousands of proteins - [Protein Function & Uses](https://schoolworkhelper.net/protein-function-uses/) - As mentioned, the range of protein functions is enormous: from passive structural elements to active motor proteins and everything in between. What characteristics of proteins are required for them to carry out these functions? While these characteristics vary from protein to protein, there are some that can be found in most proteins. We will discuss - [Enzyme catalysis, kinetics, inhibitors](https://schoolworkhelper.net/enzyme-catalysis/) - Enzymes are biological catalysts, responsible for directing the flow of chemical reactions that is the basis for life. By far the majority of enzymes are proteins, but some consist of RNA or a complex of protein and RNA. Enzymes are remarkably specific, acting on only one or a few types of molecules (called “substrates” of - [Erik Erikson and the 8 Stages of Development](https://schoolworkhelper.net/erik-erikson-and-the-8-stages-of-development/) - Erikson’s theories are the best-known theories of personality and development.Erikson believed that personality develops in a series of predetermined stages. - [Lawrence Kohlberg: The Six Stages of Moral Development](https://schoolworkhelper.net/lawrence-kohlberg-the-six-stages-of-moral-development/) - Kohlberg’s six-stage theory was an extension of Jean Piaget’s cognitive development theory (how people learn and use knowledge is affected by both social and psychological factors).Kohlberg extended on Piaget’s theory, proposing that moral development is a continual process that occurs Objections to the Kohlberg theory Does moral reasoning necessarily lead to moral behavior? The big - [Sigmund Freud and Psychosexual Development](https://schoolworkhelper.net/sigmund-freud-and-psychosexual-development/) - Main Ideas: Sigmund Freud believed that hidden forces are the cause of human behavior, rather than the obvious forces. Unconscious thoughts reveal themselves in something called the free association, such as dreams where you talk and think freely. He believed that personality consists of three major systems. The Structure of Personality: id- this starts at - [Human Nutrition Needs Throughout the Lifecycle](https://schoolworkhelper.net/human-nutrition-needs-throughout-the-lifecycle/) - 1. INFANCY (birth to 1 year) Breast milk or infant formula Pureed foods high in nutrients (40 to 50% of caloric intake from fat sources) 2. TODDLERS / PRE-SCHOOLER (1 to 5 years) Foods high in nutrients especially: folic acid, vitamin A, B6, C, E, calcium, iron, & zinc (fat intake should be 30% of - [A New Capitalist Manifesto: Hernando de Soto & Mystery of Capital](https://schoolworkhelper.net/a-new-capitalist-manifesto-hernando-de-soto-mystery-of-capital/) - De Soto and his Influence For many of the world's poor, the promises of capitalism are nothing more than empty rhetoric. Latin American economist Hernando de Soto is one of those providing the fresh thinking that is required, with his focus on the legal aspects of economic development in emerging economies. De Soto has an - [Deadliest Earthquakes on Record](https://schoolworkhelper.net/deadliest-earthquakes-on-record/) - The following table lists the deadliest earthquakes on record according to date, location, number of deaths, and magnitude. On Jan. 23, 1556, an 8.0 magnitude earthquake struck Shansi, China killing 830,000 people. Date Location Deaths Magnitude Jan. 23, 1556 Shansi, China 830,000 ~8 July 27, 1976 Tangshan, China 255,0001 7.5 Aug. 9, 1138 Aleppo, Syria - [Social Learning Theory: ALBERT BANDURA (1925-)](https://schoolworkhelper.net/social-learning-theory-albert-bandura-1925/) - Canadian, born in northern Alberta Behaviourism theory of the time stated that one’s environment causes one’s behaviour Bandura agreed that environment causes behaviour, but he also believed that behaviour causes environment – he labelled this “reciprocal determinism” – that the world and a person’s behaviour cause each other He studied personality as it interacted with - [Psychology Theorists: Lev Vygotsky, Robert Coles, Carol Gilligan](https://schoolworkhelper.net/psychology-theorists-lev-vygotsky-robert-coles-carol-gilligan/) - Lev Vygotsky (1896 – 1934) Vygotsky’s basic premise was that social interaction plays an important role in intellectual development The child’s development appears twice – first on the social level, then on an individual level He believed skills develop to a higher level with adult guidance or peer collaboration (social interaction) His theory attempts to - [Intellectual Development Theory: MARIA MONTESSORI (1870-1952)](https://schoolworkhelper.net/intellectual-development-theory-maria-montessori-1870-1952/) - § Maria Montessori pioneered the Montessori educational method which is a child-centered, alternative education method based on her theories of child development. § The method is primarily applied in preschool and elementary school settings, and it emphasizes self-directed activity on the part of the child, and observation on the part of the teacher. § The - [Growth and Development Theory: ARNOLD GESELL (1880 – 1961)](https://schoolworkhelper.net/growth-and-development-theory-arnold-gesell-1880-1961/) - Prior to the early twentieth century, scientific observations of children were not common. Arnold Gesell was one of the first psychologists to systematically describe children’s physical, social, and emotional achievements through a quantitative study of human development from birth through adolescence. He focused his research on the extensive study of a small number of children. - [Growth and Development Theory: URIE BRONFENBRENNER (1917-2005)](https://schoolworkhelper.net/growth-and-development-theory-urie-bronfenbrenner-1917-2005/) - Urie Bronfenbrenner founded the Ecological Systems Theory to understand the complex relationship between the infant, the family, and society and how they impact child development. The Ecological Systems Theory influenced the way psychologists and other social scientists approached the study of human beings in their environment. Before Bronfenbrenner, child psychologists studied the child, sociologists examined - [American Foreign Policy (1931-1941)](https://schoolworkhelper.net/american-foreign-policy-1931-1941/) - German American Economic Policy - Administer $33 billion German debt: 1919-1932 Coolidge Administration, by Pres. Coolidge monitored Germany (GE) debt (2 representatives from Britain, France, Italy, Japan, USA) Charles G. Dawes proposed Dawes Plan Fr. leaves Ruhr Valley, Allies control GE Banks & introduce new taxes 1 Billion was due in 1924 & by 1928, - [Jewish Symbols: Importance & History](https://schoolworkhelper.net/jewish-symbols-importance-history/) - The Star of David Originally, the Hebrew name Magen David -- literally "Shield of David" -- poetically referred to God. It acknowledges that our military hero, King David, did not win by his own might, but by the support of the Almighty. This is also alluded to in the third blessing after the Haftorah reading - [Hitler's Rise to Power in Germany](https://schoolworkhelper.net/hitlers-rise-to-power-in-germany/) - The Nazi Party was formed in 1919 Hitler joined the party shortly after it’s inception Germany was in a state of disarray after the First World War There were many extremist groups in Germany at the time 1919-1923 Many Germans were disillusioned after the defeat in the First World war. Ex-soldiers felt that they had - [American History & Identity: 1900-1950](https://schoolworkhelper.net/american-history-identity-1900-1950/) - 1900s: The Progressive Era Leisure time became more crucial; included family time, commercial recreation at fairs and carnivals.Time of peace/economic comfortGibson Girl was the symbol of the ideal woman every female aspired to be. The Gibson Girl was athletic, smart, independent, and ironically, didn’t seek gender equality.Men aspired to be like the Gibson girl’s suitors: - [Trials and Tribulations of the Hebrews](https://schoolworkhelper.net/trials-and-tribulations-of-the-hebrews/) - The Exile In 721 BCE the Assyrians invaded and captured Israel (the ten tribes). Most of the citizens were scattered all over. The Exile is the beginning of the Diaspora. In 586 BCE the Babylonians invaded and captured Judah (the two tribes) and destroyed Solomon’s temple in Jerusalem. Jewish leaders were taken into exile in - [Judaism: Origin & History](https://schoolworkhelper.net/judaism-origin-history/) - Judaism: Background The three religions, Judaism, Christianity and Islam trace their roots to the biblical figure Abraham. Of the three, Judaism is by far the smallest at only 1 to 2 percent of the size of the Christian and Muslim population. There are only 14 million Jews around the world (that is half the population - [Differences and Similarities Aerobic and Anaerobic Respiration](https://schoolworkhelper.net/differences-and-similarities-aerobic-and-anaerobic-respiration/) - Two Types of Anaerobic Respiration Lactic Acid Fermentation Reactants: Pyruvate and NADH Products: NAD+ and lactate (lactic acid) Occurs in Muscle cells and micro-organisms Alcohol Fermentation Reactants: Pyruvate Products: Ethanol and CO2 (waste) Occurs in Yeasts and some bacteria Aerobic Respiration Anaerobic Respiration Similarities Both processes begin with the breakdown of sugar (glucose) Both processes - [Polypropylene: Properties, Uses, Dangers](https://schoolworkhelper.net/polypropylene-properties-uses-dangers/) - Physical Properties Amorphous Density: 0.85 g/cm3 [1] Crystalline Density: 0.95 g/cm3 [2] Melting Point of 320°F (160°C) Doesn’t Soak up water (good for uses around moisture) Chemical Properties Very strong against corrosion; doesn’t react with chemicals like alkaline substances, acids, etc. Low flammability Poor UV resistance Structural Formula Functional Groups Polypropylene contains a carbon backbone - [Biological Macromolecules: Carbohydrates](https://schoolworkhelper.net/biological-macromolecules-carbohydrates/) - A biological macromolecule is defined as a large molecule made up of smaller organic molecules, known as monomers. There are four classes of biological macromolecules, one of them being carbohydrates. Carbohydrates are made of three base elements; Carbon, Hydrogen, and Oxygen in a 1:2:1 ratio. There are three different classes of carbohydrates; monosaccharides, disaccharides, and - [Opinion Essay- Baby Boomers History: the Generation that Changed the World](https://schoolworkhelper.net/baby-boom-history-the-generation-that-changed-the-world/) - A) Nuclear Family: The idea that the father goes to work to support his family and the mother stays home and devotes her time to the children. During the baby boom generation, this was seen as the ideal and most traditional family style. The media encouraged this family type by displaying it on popular television - [The Eye: Structure and Diseases](https://schoolworkhelper.net/the-eye-structure-and-diseases/) - Rods respond to low intensity light; cones, which require high intensity light, identify colour. The blind spot is where the optic nerve attaches to the retina; no rods or cones are present in this area, so there’s an absence of photosensitive cells Ciliary muscles change the shape of the lens. A thicker lens permits the - [The Nervous System: Autonomic & Central](https://schoolworkhelper.net/the-nervous-system-autonomic-central/) - Neural Circuits Reflex arc: neural circuit through the spinal cord that provides a framework for a reflex action The Central Nervous System The two components of the central nervous system are the brain and the spinal cord. Meninges are protective membranes that surround the brain and spinal cord. The Meninges is made up of three - [The Endocrine System](https://schoolworkhelper.net/the-endocrine-system/) - Hormones: chemicals released by cells that affect cells in other parts of the body Endocrine Hormones: chemicals secreted by endocrine glands directly to the blood Exocrine glands secret substances through ducts, where as endocrine glands secret directly into the blood The nervous system enables the body to adjust quickly to the environment; the endocrine system - [What Effects of Concentrations of a Substrate on Enzyme Lab Answers](https://schoolworkhelper.net/what-effects-of-concentrations-of-a-substrate-on-enzyme-lab-answers/) - An enzyme is described as a biological catalyst that speeds up the rate of a chemical reaction. In order for an enzyme to perform its given job, it needs what is known as a substrate to bind to the active site of the enzyme so that the enzyme can speed up the reaction of the - [Understanding the Theories of Attraction and Mate Selection](https://schoolworkhelper.net/understanding-the-theories-of-attraction-and-mate-selection/) - [Potassium Chloride Enthalpy Change Lab Answers](https://schoolworkhelper.net/potassium-chloride-enthalpy-change-lab-answers/) - Materials: Lab apron Eye protection Centigram or analytical balance 8-10g or unknown salt Water Thermometer 3 Styrofoam cups (calorimeter) 100 mL cylinder Filter paper Procedure: Safety equipment, including goggles were put on. 8-10g of an unknown salt on a filter paper was obtained from the teacher. The mass of the salt and filter paper were - [Liberalism: Classical, Reform, Contemporary](https://schoolworkhelper.net/liberalism-classical-reform-contemporary/) - Liberalism Classical Liberalism 1700s-1800s Locke & Smith Reform Liberalism 1800s-1900s Mill & Green Contemporary Liberalism 1930s- Keynes (1930s) & Rawls (1970s) Key Ideas Personal freedom – freedom from coercionLimited government – state serves & performs limited functionsEquality of right – everyone must abide by laws, which must be applied equally and impartiallyConsent of the governed - [Conservatism: Traditional, Neo-Conservatism, Individualist](https://schoolworkhelper.net/conservatism-traditional-neo-conservatism-individualist/) - Conservatism Classical ConservatismContemporary North America Conservatism Traditional Conservatism Individualist Conservatism Neo-Conservatism Social/Religious Conservatism Key Ideas Differences between early or classical conservatives and self-proclaimed conservatives of recent yearsOpposed to "social engineering" of society by society, social groups, or government Humans are imperfect & no structure can make them perfect Government has a very limited or particular - [Concepts of Politics: Power, Government, Society](https://schoolworkhelper.net/concepts-of-politics-power-government-society/) - Claims Society Politics Government Sovereignty(citizenship) The stats Power Claims Empirical = factual claims pointing to actual evidence Normative = evaluative (moral evaluation) Combination of both in all claims about politics, etc. Make a balance of both Society 2 or more people developing/having a social relationship with each other voluntary & spontaneous you create societies with - [Domestic Violence in Aboriginal Communities: Woman & Child Abuse](https://schoolworkhelper.net/domestic-violence-in-aboriginal-communities-woman-child-abuse/) - Domestic violence can be defined as the use of physical abuse in an intimate relationship including emotional, psychological and sexual abuse (Bopp, et al., 2006). Over the past few decades, the issue of domestic violence has become more prominent in our society. This issue within the Aboriginal community has been increasing more rapidly than ever - [Child Obesity: Who is to blame?](https://schoolworkhelper.net/child-obesity-who-is-to-blame/) - Today childhood obesity is the most common nutritional disorder affecting children and teens (Peters, 2009). Obesity is not just being overweight; it can contribute to a risk of ‍strokes, heart disease, type II diabetes, cancers and arthritis (‍McVeigh, 2009). With over 1.6 million children overweight in Canada, obesity rates in children is climbing at an - [Diabetes Insipidus & Mellitus: Treatment](https://schoolworkhelper.net/diabetes-insipidus-mellitus-treatment/) - What is diabetes insipidus? Diabetes insipidus (DI) is an endocrine disorder involving deficient production or lack of effective action of an antidiuretic hormone (ADH or vasopressin). ADH is made in the hypothalamus (lower part of the brain), stored in and secreted by the pituitary gland (a small gland located below the hypothalamus), and works on - [Detecting Amylose: Starch Lab Answers](https://schoolworkhelper.net/detecting-amylose-starch-lab-answers/) - Purpose: To see if starch is present in different mediums Materials: - White paper - Popcorn - Plain Cheerios - Crackers - Rice - Unknown substances A, B, C, D, E Apparatus: - Petri dish - Iodine - Dropper - White paper Method: A small piece of white paper was ripped off and one - [Kidney Diseases: Diabetes, Bright, Stones](https://schoolworkhelper.net/kidney-diseases-diabetes-bright-stones/) - Diabetes Mellitus Caused by inadequate secretion of insulin from islet cells in the pancreas Less insulin means blood sugar level tends to rise Cells of proximal tubule are supplied with enough ATP to reabsorb .1 % blood sugar, but with disease much higher blood sugar concentrations are found with the excess sugar remaining in the - [Ionization Energy Trend](https://schoolworkhelper.net/ionization-energy-trend/) - The graph shows three same structured gradual increases in three different areas- from elements 2 to 10, 11 to 18, 31 to 36. As the atomic number increases, the ionization energy slowly decreases. After Elements 2, 10, 18 and 36, the ionization energy level drops by a significant amount. Between elements 20 and 29, the - [The Armenian Genocide: Causes & History](https://schoolworkhelper.net/the-armenian-genocide-causes-history/) - What comes to your head when you here the sounds of guns and screams. When women and children are wandering the streets begging, pleading for mercy. All the Turkish soldiers are wandering, with a gun in one hand and an Armenian’s head in the other. The terrified screams, "No! Please don't! Not my children! Please!!" - [DDT: Environmental Impact, Dangers, History](https://schoolworkhelper.net/ddt-environmental-impact-dangers-history/) - Pests have plagued humanity for as long as history has been kept, leading to many diseases in the process. Many people have tried to fight these pests and diseases, but came up empty. DDT was the world’s first known pesticide and is arguably the world’s most well known. DDT was first synthesized by Othmar Ziedler - [DDT: Properties, Uses, WHMIS](https://schoolworkhelper.net/ddt-properties-uses-whmis/) - Common Names: Anofex, Cesarex, Chlorophenothane, Dedelo, p, p'-DDT, Dinocide, Didimac, Digmar, ENT 1506, Genitox, Guesapon, Guesarol, Gexarex, Gyron, Hildit, Ixodex, Kopsol, Neocid, OMS 16, Micro DDT 75, Pentachlorin, Rukseam, R50 and Zerdane. Physical Properties of DDT - Created by the reaction of trichloroethanol with chlorobenzene - Stable, Nonflammable, Combustible molecule - Able to perform substitution - [John Dalton: Biography & Contributions](https://schoolworkhelper.net/john-dalton-biography-contributions/) - Biographical Information Born on September 6, 1766, in Eaglesfield, Cumberland County, England Son of a Quaker weaver Suffers from colour blindness Was educated at a Quaker school, where he taught at age 12 Moved to Kendal in 1781 to teach at another school Went to Manchester in 1793 to teach at the New College and - [Enzymes in the Digestive System](https://schoolworkhelper.net/enzymes-in-the-digestive-system/) - Name of Enzyme Substrate Location Task Products Salivary Amylase (likes pH level of around 6.2-7.4) Amylose in the mouth Saliva which is released from the salivary glands Aid in the hydrolysis of the starch amylose into the disaccharide maltose (glycocidic bond) Maltose, and Amylose Pepsinogen No substrate, inactive form of pepsin Produced in the gastric - [Major Hormones: Origin, Target, Function](https://schoolworkhelper.net/major-hormones-origin-target-function/) - HORMONE GLAND ORIGIN TARGET TISSUE FUNCTION Adrenocorticotropic Pituitary gland (anterior) Adrenal cortex Triggers secretion of hydrocortisone from the adrenal gland Growth hormone Pituitary gland (anterior) Throughout body Stimulates growth and development Follicle-stimulating hormone Pituitary gland (anterior) Sex glands Stimulates female egg maturation and male sperm production Luteinizing hormone Pituitary gland (anterior) Sex glands Stimulates female - [Bottled Water & Pollution Diffusion](https://schoolworkhelper.net/bottled-water-pollution-diffusion/) - Lately the North American society has been obsessed with bottled water. It has become the fastest growing drink, but many people do not realize that it is just as safe, and much cheaper, to just turn on the tap. Bottled water companies sell their product by taking advantage of consumer concerns about the condition of - [Chemistry Nobel Prize Winners 2004: Irwin Rose & Avram Hershko](https://schoolworkhelper.net/chemistry-nobel-prize-winners-2004-irwin-rose-avram-hershko/) - The Nobel Prize is an international award that is given yearly for achievements in physics, chemistry, physiology or medicine, and peace which was set up in 1901 by Alfred Nobel with each prize consisting of a medal, personal diploma and prize amount. The prize in economic sciences was instituted in 1968 by the Sveriges Riskbank - [Ace-tylsalicylic Acid (Aspirin) Titration Lab](https://schoolworkhelper.net/ace-tylsalicylic-acid-aspirin-titration-lab/) - Aspirin (originally a legally restricted brand name owned by Bayer for its brand of ace- tylsalicylic acid, but now a generic term) has been in use as an analgesic (pain-killer) and antipyretic (fever-reducer) for over a century. During most of that time, little was known about its mode of action in the body, although this - [Different Types of Parents](https://schoolworkhelper.net/different-types-of-parents/) - Anyone who is biologically capable and who can find another biologically capable person can become a parent. Parenthood is a state that has no special conditions, and one must pass no qualifying exam to enter it. Since the word parent encompasses such a large number of people, it is easy to understand why there are - [Refraction of Light Lab Answers](https://schoolworkhelper.net/refraction-of-light-lab-answers/) - Refraction of Light PART I This laboratory was designed to investigate the behaviour of light as it travels through a less dense into a denser medium. Materials Ray Box with combSemicircular plastic block Procedure Placed the semicircular plastic block on the centre of a blank sheet of paper. Traced its outline and indicated the centre - [Violin: Parts & String Instruments](https://schoolworkhelper.net/violin-parts-string-instruments/) - Throughout history the violin has been known for making one of the most beautiful sounds in music. With the strings, body and bow all making a difference, the violin can produce a wide variety of sounds from a very high pitched to a very low pitched one. Stringed instruments which include guitars and violins consist - [The Destruction of the Amazon & Chico Mendes](https://schoolworkhelper.net/the-destruction-of-the-amazon-chico-mendes/) - An extractive reserve is a concept that was produced and formed by Chico Mendes and Mary Helena Allegretti which relate to areas designated for the protection and sustenance of the environment and their inhabitants who practise their customary activities of rubber tapping. Extractive reserves were seen by the rubber tappers to be a solution to - [Pesticides & Naled: Environmental Impact, Legislation, Costs](https://schoolworkhelper.net/pesticides-naled-environmental-impact-legislation-costs/) - With environmentalists constantly searching for a safer insecticide to deal with those pesky mosquitoes, naled has often been the choice for many. Having been registered for use since 1959 in the United States, about one million pounds of the organophosphate pesticide have been used every year with seventy percent used towards mosquito control. Primarily produced - [How Car Brakes Work: Physics](https://schoolworkhelper.net/how-car-breaks-work-physics/) - Cars have many devices to help them accelerate and reach a certain velocity, but slowing down the automobile is a very important function to achieve as well. Two ways cars are able to slow down their velocity is through the ability of the transmission to downshift and the brakes using friction to make the wheels - [Hearing and Sound Aids: Waves & Sounds](https://schoolworkhelper.net/hearing-and-sound-aids-waves-sounds/) - In the world many people take the gift of hearing for granted because they have never experienced anything else. What people do not realize is that many people have very weak or no hearing at all. With the invention of the hearing aid, the gift of sound has been shared with many of these people - [Energy Debate: Nuclear Power](https://schoolworkhelper.net/energy-debate-nuclear-power/) - Nuclear power has been a topic of discussion for many decades. Many antinuclear lobbyists are against the use of nuclear power, while a lot of politicians believe that it will be one of the main sources of energy in the future. Dalton McGuinty, who while running for the position of premiere of Ontario, used in - [Cellular Organelles & Structures](https://schoolworkhelper.net/cellular-organelles-structures/) - Organelle Structure Function Nucleus -classified as eukaryotic or prokaryotic depending on whether or not it has a membrane bound-Heredity or genetic information is organized into threadlike structures called chromosomes.-contains DNA-composed of nucleic acids and proteins - control centre of the cell - directs all cell activity-directs other cell activities. Cell Membrane -composed of proteins and ## Pages - [Homepage](https://schoolworkhelper.net/) - Your online site for school work help and homework help. Science, English, History, Civics, Art, Business, Law, Geography, all free! SchoolWorkHelper. - [Privacy Policy](https://schoolworkhelper.net/privacy-policy/) - Mediavine Programmatic Advertising Mediavine Programmatic Advertising (Ver 1.1) The Website works with Mediavine to manage third-party interest-based advertising appearing on the Website. Mediavine serves content and advertisements when you visit the Website, which may use first and third-party cookies. A cookie is a small text file which is sent to your computer or mobile device - [About Us- Charity](https://schoolworkhelper.net/about-us/) - Schoolworkhelper.net is an educational charity that was founded in 2010 by Dr. Christopher Humphreys, MD. It pertains to various topics including: Science (Biology, Chemistry, Earth /Space, Environment), English, Sociology, Philosophy, Business, History, Law, Art etc. These articles have been compiled from teachers, graduate, university and high school students who share the common desire of ensuring - [Contact Us](https://schoolworkhelper.net/contact-us/) - Fill our contact forms with your message and we will get back to you as soon as possible. Feel free to contact us. ## Partners, Clients, etc. - [35](https://schoolworkhelper.net/dt_logos/35/) - [43](https://schoolworkhelper.net/dt_logos/43/) - [1](https://schoolworkhelper.net/dt_logos/1/) - [28](https://schoolworkhelper.net/dt_logos/28/) - [9](https://schoolworkhelper.net/dt_logos/9-2/) - [20](https://schoolworkhelper.net/dt_logos/20/) - [13](https://schoolworkhelper.net/dt_logos/13-2/) - [5](https://schoolworkhelper.net/dt_logos/5-2/) - [2](https://schoolworkhelper.net/dt_logos/2/) - [3](https://schoolworkhelper.net/dt_logos/3-2/) - [4](https://schoolworkhelper.net/dt_logos/4-2/) - [6](https://schoolworkhelper.net/dt_logos/6-2/) - [10](https://schoolworkhelper.net/dt_logos/10-2/) - [14](https://schoolworkhelper.net/dt_logos/14-2/) - [12](https://schoolworkhelper.net/dt_logos/12/) - [15](https://schoolworkhelper.net/dt_logos/15-2/) - [16](https://schoolworkhelper.net/dt_logos/16-2/) - [17](https://schoolworkhelper.net/dt_logos/17/) - [21](https://schoolworkhelper.net/dt_logos/21/) - [22](https://schoolworkhelper.net/dt_logos/22/) - [23](https://schoolworkhelper.net/dt_logos/23/) - [24](https://schoolworkhelper.net/dt_logos/24/) - [25](https://schoolworkhelper.net/dt_logos/25/) - [26](https://schoolworkhelper.net/dt_logos/26/) - [27](https://schoolworkhelper.net/dt_logos/27/) - [29](https://schoolworkhelper.net/dt_logos/29/) - [30](https://schoolworkhelper.net/dt_logos/30/) - [31](https://schoolworkhelper.net/dt_logos/31/) - [32](https://schoolworkhelper.net/dt_logos/32/) - [33](https://schoolworkhelper.net/dt_logos/33/) - [34](https://schoolworkhelper.net/dt_logos/34/) - [38](https://schoolworkhelper.net/dt_logos/38/) - [36](https://schoolworkhelper.net/dt_logos/36/) - [37](https://schoolworkhelper.net/dt_logos/37/) - [39](https://schoolworkhelper.net/dt_logos/39/) - [40](https://schoolworkhelper.net/dt_logos/40/) - [44](https://schoolworkhelper.net/dt_logos/44/) - [45](https://schoolworkhelper.net/dt_logos/45/) - [41](https://schoolworkhelper.net/dt_logos/41/) - [18](https://schoolworkhelper.net/dt_logos/18/) ## Categories - [English](https://schoolworkhelper.net/category/english/) - [Science](https://schoolworkhelper.net/category/science/) - [Sociology & Philosophy](https://schoolworkhelper.net/category/sociology-philosophy/) - [Law & Politics](https://schoolworkhelper.net/category/law-politics/) - [Business & Economics](https://schoolworkhelper.net/category/business-economics/) - [Media & Art](https://schoolworkhelper.net/category/media-art/) - [History](https://schoolworkhelper.net/category/history/) - [Careers](https://schoolworkhelper.net/category/careers/) - [Computer Technology](https://schoolworkhelper.net/category/computer-technology/) ## Tags - [Activity 6.1.1](https://schoolworkhelper.net/tag/activity-6-1-1/) - [Diagnosing Blood Diseases](https://schoolworkhelper.net/tag/diagnosing-blood-diseases/) - [Haemoglobin](https://schoolworkhelper.net/tag/haemoglobin/) - [Red Blood Cell](https://schoolworkhelper.net/tag/red-blood-cell/) - [White Blood Cell](https://schoolworkhelper.net/tag/white-blood-cell/) - [Platelets](https://schoolworkhelper.net/tag/platelets/) - [Blood Clotting](https://schoolworkhelper.net/tag/blood-clotting/) - [Red Blood Cells](https://schoolworkhelper.net/tag/red-blood-cells/) - [White Blood Cells](https://schoolworkhelper.net/tag/white-blood-cells/) - [Helper T cell](https://schoolworkhelper.net/tag/helper-t-cell/) - [Polycythemia](https://schoolworkhelper.net/tag/polycythemia/) - [Sickle Cell anaemia](https://schoolworkhelper.net/tag/sickle-cell-anaemia/) - [Thrombocytopenic](https://schoolworkhelper.net/tag/thrombocytopenic/) - [Artificial Sweeteners](https://schoolworkhelper.net/tag/artificial-sweeteners/) - [Analysis Questions](https://schoolworkhelper.net/tag/analysis-questions/) - [Splenda](https://schoolworkhelper.net/tag/splenda/) - [Saccharin](https://schoolworkhelper.net/tag/saccharin/) - [Neotame](https://schoolworkhelper.net/tag/neotame/) - [Surcalose](https://schoolworkhelper.net/tag/surcalose/) - [denature](https://schoolworkhelper.net/tag/denature/) - [biuret](https://schoolworkhelper.net/tag/biuret/) - [Maltodextins](https://schoolworkhelper.net/tag/maltodextins/) - [Animal Farm Critical Passage](https://schoolworkhelper.net/tag/animal-farm-critical-passage/) - [Animal Farm](https://schoolworkhelper.net/tag/animal-farm/) - [Critical Passage](https://schoolworkhelper.net/tag/critical-passage/) - [Summary](https://schoolworkhelper.net/tag/summary/) - [Analysis](https://schoolworkhelper.net/tag/analysis/) - [Stalinism](https://schoolworkhelper.net/tag/stalinism/) - [George Orwell](https://schoolworkhelper.net/tag/george-orwell/) - [Old Major](https://schoolworkhelper.net/tag/old-major/) - [Napoleon](https://schoolworkhelper.net/tag/napoleon/) - [Snowball](https://schoolworkhelper.net/tag/snowball/) - [Squealer](https://schoolworkhelper.net/tag/squealer/) - [Mr. Jones](https://schoolworkhelper.net/tag/mr-jones/) - [Boxer](https://schoolworkhelper.net/tag/boxer/) - [Punishments for Murderers](https://schoolworkhelper.net/tag/punishments-for-murderers/) - [Punishments](https://schoolworkhelper.net/tag/punishments/) - [Murderers](https://schoolworkhelper.net/tag/murderers/) - [First degree murder](https://schoolworkhelper.net/tag/first-degree-murder/) - [Second degree murder](https://schoolworkhelper.net/tag/second-degree-murder/) - [Manslaughter](https://schoolworkhelper.net/tag/manslaughter/) - [Negligent killing or vehicular killing](https://schoolworkhelper.net/tag/negligent-killing-or-vehicular-killing/) - [Infanticide](https://schoolworkhelper.net/tag/infanticide/) - [Abortions](https://schoolworkhelper.net/tag/abortions/) - [Assisted Suicide](https://schoolworkhelper.net/tag/assisted-suicide/) - [Finland](https://schoolworkhelper.net/tag/finland/) - [Possession/ Trafficking of an illegal narcotic](https://schoolworkhelper.net/tag/possession-trafficking-of-an-illegal-narcotic/) - [30 grams](https://schoolworkhelper.net/tag/30-grams/) - [Ecstasy/ GHB/ LSD](https://schoolworkhelper.net/tag/ecstasy-ghb-lsd/) - [Israel](https://schoolworkhelper.net/tag/israel/) - [Brazil](https://schoolworkhelper.net/tag/brazil/) - [Texas](https://schoolworkhelper.net/tag/texas/) - [Canada](https://schoolworkhelper.net/tag/canada/) - [United States](https://schoolworkhelper.net/tag/united-states/) - [Breathing Lab](https://schoolworkhelper.net/tag/breathing-lab/) - [Discussion Questions](https://schoolworkhelper.net/tag/discussion-questions/) - [Physical fitness](https://schoolworkhelper.net/tag/physical-fitness/) - [Chest volume](https://schoolworkhelper.net/tag/chest-volume/) - [Low Air Pressure](https://schoolworkhelper.net/tag/low-air-pressure/) - [Vital capacity](https://schoolworkhelper.net/tag/vital-capacity/) - [Chronic Lung Complications](https://schoolworkhelper.net/tag/chronic-lung-complications/) - [Bronchitis](https://schoolworkhelper.net/tag/bronchitis/) - [Lung Cancer](https://schoolworkhelper.net/tag/lung-cancer/) - [Obesity](https://schoolworkhelper.net/tag/obesity/) - [Audio Reproduction](https://schoolworkhelper.net/tag/audio-reproduction/) - [Speakers](https://schoolworkhelper.net/tag/speakers/) - [Microphones](https://schoolworkhelper.net/tag/microphones/) - [Drivers](https://schoolworkhelper.net/tag/drivers/) - [Delay](https://schoolworkhelper.net/tag/delay/) - [Reverberation](https://schoolworkhelper.net/tag/reverberation/) - [Screech](https://schoolworkhelper.net/tag/screech/) - [How we hear](https://schoolworkhelper.net/tag/how-we-hear/) - [resonant frequency](https://schoolworkhelper.net/tag/resonant-frequency/) - [Safety Precautions](https://schoolworkhelper.net/tag/safety-precautions/) - [Billy Elliot](https://schoolworkhelper.net/tag/billy-elliot/) - [Movie Analysis](https://schoolworkhelper.net/tag/movie-analysis/) - [Bill C-484](https://schoolworkhelper.net/tag/bill-c-484/) - [Criminal negligence 219](https://schoolworkhelper.net/tag/criminal-negligence-219/) - [R.S.](https://schoolworkhelper.net/tag/r-s/) - [c. C-34](https://schoolworkhelper.net/tag/c-c-34/) - [s. 202](https://schoolworkhelper.net/tag/s-202/) - [British Columbia Court Appeal](https://schoolworkhelper.net/tag/british-columbia-court-appeal/) - [Supreme Court of Canada](https://schoolworkhelper.net/tag/supreme-court-of-canada/) - [Unborn Victims of Crime Act](https://schoolworkhelper.net/tag/unborn-victims-of-crime-act/) - [Conservative MP Ken Epp](https://schoolworkhelper.net/tag/conservative-mp-ken-epp/) - [Charter of Rights and Freedoms](https://schoolworkhelper.net/tag/charter-of-rights-and-freedoms/) - [R. v. Sullivan](https://schoolworkhelper.net/tag/r-v-sullivan/) - [Courtroom Procedure](https://schoolworkhelper.net/tag/courtroom-procedure/) - [Courtroom](https://schoolworkhelper.net/tag/courtroom/) - [Procedure](https://schoolworkhelper.net/tag/procedure/) - [Ticker Tap Lab](https://schoolworkhelper.net/tag/ticker-tap-lab/) - [average velocity](https://schoolworkhelper.net/tag/average-velocity/) - [constant acceleration](https://schoolworkhelper.net/tag/constant-acceleration/) - [velocity-time graph](https://schoolworkhelper.net/tag/velocity-time-graph/) - [position- time graph](https://schoolworkhelper.net/tag/position-time-graph/) - [acceleration- time](https://schoolworkhelper.net/tag/acceleration-time/) - [displacement](https://schoolworkhelper.net/tag/displacement/) - [China has 44 million missing women](https://schoolworkhelper.net/tag/china-has-44-million-missing-women/) - [Case Study](https://schoolworkhelper.net/tag/case-study/) - [child gender problems](https://schoolworkhelper.net/tag/child-gender-problems/) - [society hierarchy](https://schoolworkhelper.net/tag/society-hierarchy/) - [sexist perspective](https://schoolworkhelper.net/tag/sexist-perspective/) - [Dr. V. Parameshvara](https://schoolworkhelper.net/tag/dr-v-parameshvara/) - [India](https://schoolworkhelper.net/tag/india/) - [females births](https://schoolworkhelper.net/tag/females-births/) - [Enforcement and Application. Charter Rights and Freedoms](https://schoolworkhelper.net/tag/enforcement-and-application-charter-rights-and-freedoms/) - [R. v. Oakes](https://schoolworkhelper.net/tag/r-v-oakes/) - [Reverse onus](https://schoolworkhelper.net/tag/reverse-onus/) - [burden of proof](https://schoolworkhelper.net/tag/burden-of-proof/) - [PROPERTIONAL TEST](https://schoolworkhelper.net/tag/propertional-test/) - [override power](https://schoolworkhelper.net/tag/override-power/) - [Public Pressure](https://schoolworkhelper.net/tag/public-pressure/) - [Charter](https://schoolworkhelper.net/tag/charter/) - [Product Development](https://schoolworkhelper.net/tag/product-development/) - [Idea Generation](https://schoolworkhelper.net/tag/idea-generation/) - [Idea Screening](https://schoolworkhelper.net/tag/idea-screening/) - [Concept Development](https://schoolworkhelper.net/tag/concept-development/) - [Business Analysis](https://schoolworkhelper.net/tag/business-analysis/) - [Beta Testing](https://schoolworkhelper.net/tag/beta-testing/) - [Technical Implementation](https://schoolworkhelper.net/tag/technical-implementation/) - [Commercialization](https://schoolworkhelper.net/tag/commercialization/) - [Invention vs. Innovation](https://schoolworkhelper.net/tag/invention-vs-innovation/) - [Canadian Inventions](https://schoolworkhelper.net/tag/canadian-inventions/) - [Java](https://schoolworkhelper.net/tag/java/) - [Lightbulb](https://schoolworkhelper.net/tag/lightbulb/) - [Insulin](https://schoolworkhelper.net/tag/insulin/) - [Telephone](https://schoolworkhelper.net/tag/telephone/) - [Wonderbra](https://schoolworkhelper.net/tag/wonderbra/) - [R. v. Greyeyes](https://schoolworkhelper.net/tag/r-v-greyeyes/) - [Aiding and Abetting](https://schoolworkhelper.net/tag/aiding-and-abetting/) - [cocaine](https://schoolworkhelper.net/tag/cocaine/) - [possessing and trafficking](https://schoolworkhelper.net/tag/possessing-and-trafficking/) - [illegal drugs](https://schoolworkhelper.net/tag/illegal-drugs/) - [R. v. Parker](https://schoolworkhelper.net/tag/r-v-parker/) - [Trafficking of Schedule II Drugs](https://schoolworkhelper.net/tag/trafficking-of-schedule-ii-drugs/) - [Possession of Schedule II Drug](https://schoolworkhelper.net/tag/possession-of-schedule-ii-drug/) - [Alcohol and Tabbacco](https://schoolworkhelper.net/tag/alcohol-and-tabbacco/) - [Section 7 of the Charter of Rights and Freedoms](https://schoolworkhelper.net/tag/section-7-of-the-charter-of-rights-and-freedoms/) - [Everyone has the right to life](https://schoolworkhelper.net/tag/everyone-has-the-right-to-life/) - [liberty and security of the person and the right not to be deprived thereof except in accordance with the principles of fundamental justice.”](https://schoolworkhelper.net/tag/liberty-and-security-of-the-person-and-the-right-not-to-be-deprived-thereof-except-in-accordance-with-the-principles-of-fundamental-justice-”/) - [Ban on driving distractions passes final reading](https://schoolworkhelper.net/tag/ban-on-driving-distractions-passes-final-reading/) - [cellphones](https://schoolworkhelper.net/tag/cellphones/) - [handheld GPS](https://schoolworkhelper.net/tag/handheld-gps/) - [Mp3 players](https://schoolworkhelper.net/tag/mp3-players/) - [with driving and cell phone use](https://schoolworkhelper.net/tag/with-driving-and-cell-phone-use/) - [including text messaging](https://schoolworkhelper.net/tag/including-text-messaging/) - [“hands-free” Bluetooth](https://schoolworkhelper.net/tag/“hands-free”-bluetooth/) - [using a handheld and driving](https://schoolworkhelper.net/tag/using-a-handheld-and-driving/) - [Does Sports affect Academic Average?](https://schoolworkhelper.net/tag/does-sports-affect-academic-average/) - [sports vs. grades](https://schoolworkhelper.net/tag/sports-vs-grades/) - [lab](https://schoolworkhelper.net/tag/lab/) - [THE DIGESTIVE SYSTEM](https://schoolworkhelper.net/tag/the-digestive-system/) - [tract](https://schoolworkhelper.net/tag/tract/) - [ECF and blood](https://schoolworkhelper.net/tag/ecf-and-blood/) - [release of hormones](https://schoolworkhelper.net/tag/release-of-hormones/) - [enzymes and mucus](https://schoolworkhelper.net/tag/enzymes-and-mucus/) - [mastication](https://schoolworkhelper.net/tag/mastication/) - [voluntary action](https://schoolworkhelper.net/tag/voluntary-action/) - [Amylase](https://schoolworkhelper.net/tag/amylase/) - [bolus](https://schoolworkhelper.net/tag/bolus/) - [esophagus](https://schoolworkhelper.net/tag/esophagus/) - [pepsinogen](https://schoolworkhelper.net/tag/pepsinogen/) - [HCl](https://schoolworkhelper.net/tag/hcl/) - [Villi](https://schoolworkhelper.net/tag/villi/) - [Cholecystokinin](https://schoolworkhelper.net/tag/cholecystokinin/) - [Bile](https://schoolworkhelper.net/tag/bile/) - [Hamlet Essay](https://schoolworkhelper.net/tag/hamlet-essay/) - [Forms of Energy](https://schoolworkhelper.net/tag/forms-of-energy/) - [Thermal](https://schoolworkhelper.net/tag/thermal/) - [Electrical](https://schoolworkhelper.net/tag/electrical/) - [Radiant](https://schoolworkhelper.net/tag/radiant/) - [Nuclear potential](https://schoolworkhelper.net/tag/nuclear-potential/) - [Gravitational potential](https://schoolworkhelper.net/tag/gravitational-potential/) - [Kinetic](https://schoolworkhelper.net/tag/kinetic/) - [Elastic potential](https://schoolworkhelper.net/tag/elastic-potential/) - [Sound](https://schoolworkhelper.net/tag/sound/) - [Chemical potential](https://schoolworkhelper.net/tag/chemical-potential/) - [Fish](https://schoolworkhelper.net/tag/fish/) - [Shark Information](https://schoolworkhelper.net/tag/shark-information/) - [Aquatic vertebrate animals](https://schoolworkhelper.net/tag/aquatic-vertebrate-animals/) - [Typically cold-blooded](https://schoolworkhelper.net/tag/typically-cold-blooded/) - [Covered with scales](https://schoolworkhelper.net/tag/covered-with-scales/) - [quipped with two sets of paired fins](https://schoolworkhelper.net/tag/quipped-with-two-sets-of-paired-fins/) - [Kingdom: Animalia](https://schoolworkhelper.net/tag/kingdom-animalia/) - [(1) - operculum (gill cover)](https://schoolworkhelper.net/tag/1-operculum-gill-cover/) - [(2) - lateral line](https://schoolworkhelper.net/tag/2-lateral-line/) - [(3) - dorsal fin](https://schoolworkhelper.net/tag/3-dorsal-fin/) - [(4) - fat fin](https://schoolworkhelper.net/tag/4-fat-fin/) - [(5) - caudal peduncle](https://schoolworkhelper.net/tag/5-caudal-peduncle/) - [(6) - caudal fin](https://schoolworkhelper.net/tag/6-caudal-fin/) - [(7) - anal fin](https://schoolworkhelper.net/tag/7-anal-fin/) - [(8) - photophores](https://schoolworkhelper.net/tag/8-photophores/) - [(9) - pelvic fins (paired)](https://schoolworkhelper.net/tag/9-pelvic-fins-paired/) - [(10) - pectoral fins (paired)](https://schoolworkhelper.net/tag/10-pectoral-fins-paired/) - [BullShark](https://schoolworkhelper.net/tag/bullshark/) - [The bull shark](https://schoolworkhelper.net/tag/the-bull-shark/) - [whaler shark](https://schoolworkhelper.net/tag/whaler-shark/) - [Zambezi shark](https://schoolworkhelper.net/tag/zambezi-shark/) - [Zambi](https://schoolworkhelper.net/tag/zambi/) - [Nicaragua](https://schoolworkhelper.net/tag/nicaragua/) - [Bull sharks](https://schoolworkhelper.net/tag/bull-sharks/) - [Reproduction](https://schoolworkhelper.net/tag/reproduction/) - [viviparous](https://schoolworkhelper.net/tag/viviparous/) - [Importance of Fish in Ecosystem](https://schoolworkhelper.net/tag/importance-of-fish-in-ecosystem/) - [Jane Goodall](https://schoolworkhelper.net/tag/jane-goodall/) - [Chimpanzees of Gombe](https://schoolworkhelper.net/tag/chimpanzees-of-gombe/) - [Lack complex language](https://schoolworkhelper.net/tag/lack-complex-language/) - [Development of Sophisticated Technology](https://schoolworkhelper.net/tag/development-of-sophisticated-technology/) - [anonymity](https://schoolworkhelper.net/tag/anonymity/) - [Physiological Differences](https://schoolworkhelper.net/tag/physiological-differences/) - [bi pedalism](https://schoolworkhelper.net/tag/bi-pedalism/) - [Use of Tools](https://schoolworkhelper.net/tag/use-of-tools/) - [War](https://schoolworkhelper.net/tag/war/) - [Culture](https://schoolworkhelper.net/tag/culture/) - [Should Euthanasia Be Legalized?](https://schoolworkhelper.net/tag/should-euthanasia-be-legalized/) - [Euthanasia](https://schoolworkhelper.net/tag/euthanasia/) - [Legalized](https://schoolworkhelper.net/tag/legalized/) - [Dutch law](https://schoolworkhelper.net/tag/dutch-law/) - [Voluntary](https://schoolworkhelper.net/tag/voluntary/) - [Act of Euthanasia](https://schoolworkhelper.net/tag/act-of-euthanasia/) - [Robert Latimer](https://schoolworkhelper.net/tag/robert-latimer/) - [Disabled People](https://schoolworkhelper.net/tag/disabled-people/) - [Tracy Latimer](https://schoolworkhelper.net/tag/tracy-latimer/) - [Animal Farm Essay](https://schoolworkhelper.net/tag/animal-farm-essay/) - [Refraction of Light](https://schoolworkhelper.net/tag/refraction-of-light/) - [the movie](https://schoolworkhelper.net/tag/the-movie/) - [explanation](https://schoolworkhelper.net/tag/explanation/) - [Leonard](https://schoolworkhelper.net/tag/leonard/) - [Natalie](https://schoolworkhelper.net/tag/natalie/) - [The White Squall](https://schoolworkhelper.net/tag/the-white-squall/) - [Essay](https://schoolworkhelper.net/tag/essay/) - [Caribbean](https://schoolworkhelper.net/tag/caribbean/) - [R v. Turner (S.A.)](https://schoolworkhelper.net/tag/r-v-turner-s-a/) - [John Ryan’s mother](https://schoolworkhelper.net/tag/john-ryan’s-mother/) - [actus reus](https://schoolworkhelper.net/tag/actus-reus/) - [malnutrition](https://schoolworkhelper.net/tag/malnutrition/) - [murder](https://schoolworkhelper.net/tag/murder/) - [criminal negligence](https://schoolworkhelper.net/tag/criminal-negligence/) - [murder her child](https://schoolworkhelper.net/tag/murder-her-child/) - [Rain man](https://schoolworkhelper.net/tag/rain-man/) - [Raymond](https://schoolworkhelper.net/tag/raymond/) - [autistic savant](https://schoolworkhelper.net/tag/autistic-savant/) - [impaired social interaction](https://schoolworkhelper.net/tag/impaired-social-interaction/) - [communication](https://schoolworkhelper.net/tag/communication/) - [echolalia](https://schoolworkhelper.net/tag/echolalia/) - [Charlie](https://schoolworkhelper.net/tag/charlie/) - [Susanna](https://schoolworkhelper.net/tag/susanna/) - [playing 21 in Las Vegas](https://schoolworkhelper.net/tag/playing-21-in-las-vegas/) - [Motion Lab](https://schoolworkhelper.net/tag/motion-lab/) - [A Stroll in the Hall](https://schoolworkhelper.net/tag/a-stroll-in-the-hall/) - [Motion Lab answers](https://schoolworkhelper.net/tag/motion-lab-answers/) - [Motion Lab help](https://schoolworkhelper.net/tag/motion-lab-help/) - [Physics Lab: A Stroll in the Hall](https://schoolworkhelper.net/tag/physics-lab-a-stroll-in-the-hall/) - [velocity](https://schoolworkhelper.net/tag/velocity/) - [vector quantity](https://schoolworkhelper.net/tag/vector-quantity/) - [Observations](https://schoolworkhelper.net/tag/observations/) - [Calculations](https://schoolworkhelper.net/tag/calculations/) - [Human Error](https://schoolworkhelper.net/tag/human-error/) - [Equipment Error](https://schoolworkhelper.net/tag/equipment-error/) - [Positive Slope](https://schoolworkhelper.net/tag/positive-slope/) - [Negative Slope](https://schoolworkhelper.net/tag/negative-slope/) - [Conclusion](https://schoolworkhelper.net/tag/conclusion/) - [Ticker Tape lab](https://schoolworkhelper.net/tag/ticker-tape-lab/) - [acceleration](https://schoolworkhelper.net/tag/acceleration/) - [Answers](https://schoolworkhelper.net/tag/answers/) - [Physics](https://schoolworkhelper.net/tag/physics/) - [Variables](https://schoolworkhelper.net/tag/variables/) - [Error Analysis](https://schoolworkhelper.net/tag/error-analysis/) - [ticker timer](https://schoolworkhelper.net/tag/ticker-timer/) - [Stanley](https://schoolworkhelper.net/tag/stanley/) - [Milgram](https://schoolworkhelper.net/tag/milgram/) - [Experiment](https://schoolworkhelper.net/tag/experiment/) - [The Learner](https://schoolworkhelper.net/tag/the-learner/) - [Teacher](https://schoolworkhelper.net/tag/teacher/) - [electrical shock](https://schoolworkhelper.net/tag/electrical-shock/) - [90V- 450V](https://schoolworkhelper.net/tag/90v-450v/) - [Allergic Reactions and Allergies](https://schoolworkhelper.net/tag/allergic-reactions-and-allergies/) - [Allergy](https://schoolworkhelper.net/tag/allergy/) - [atopy](https://schoolworkhelper.net/tag/atopy/) - [Causes](https://schoolworkhelper.net/tag/causes/) - [namely host](https://schoolworkhelper.net/tag/namely-host/) - [environmental factors](https://schoolworkhelper.net/tag/environmental-factors/) - [early childhood](https://schoolworkhelper.net/tag/early-childhood/) - [environmental pollution](https://schoolworkhelper.net/tag/environmental-pollution/) - [allergen levels](https://schoolworkhelper.net/tag/allergen-levels/) - [dietary changes](https://schoolworkhelper.net/tag/dietary-changes/) - [Allergy Pathology](https://schoolworkhelper.net/tag/allergy-pathology/) - [antigen](https://schoolworkhelper.net/tag/antigen/) - [mucous membrane](https://schoolworkhelper.net/tag/mucous-membrane/) - [T-cell](https://schoolworkhelper.net/tag/t-cell/) - [B-cell](https://schoolworkhelper.net/tag/b-cell/) - [IgE](https://schoolworkhelper.net/tag/ige/) - [Mast cells](https://schoolworkhelper.net/tag/mast-cells/) - [Basophils cells](https://schoolworkhelper.net/tag/basophils-cells/) - [antibodies](https://schoolworkhelper.net/tag/antibodies/) - [stuffiness](https://schoolworkhelper.net/tag/stuffiness/) - [sneezing](https://schoolworkhelper.net/tag/sneezing/) - [teary eyes](https://schoolworkhelper.net/tag/teary-eyes/) - [Allergy Diagnosis](https://schoolworkhelper.net/tag/allergy-diagnosis/) - [Allergy Skin Testing](https://schoolworkhelper.net/tag/allergy-skin-testing/) - [Allergy Blood Testing](https://schoolworkhelper.net/tag/allergy-blood-testing/) - [Allergy Treatment](https://schoolworkhelper.net/tag/allergy-treatment/) - [Allergy Future Cures](https://schoolworkhelper.net/tag/allergy-future-cures/) - [Periodic Table](https://schoolworkhelper.net/tag/periodic-table/) - [A business acquisition](https://schoolworkhelper.net/tag/a-business-acquisition/) - [a takeover](https://schoolworkhelper.net/tag/a-takeover/) - [how does a takeover work](https://schoolworkhelper.net/tag/how-does-a-takeover-work/) - [business takeover](https://schoolworkhelper.net/tag/business-takeover/) - [business acquisition](https://schoolworkhelper.net/tag/business-acquisition/) - [buyer buys the shares](https://schoolworkhelper.net/tag/buyer-buys-the-shares/) - [liabilities](https://schoolworkhelper.net/tag/liabilities/) - [assets](https://schoolworkhelper.net/tag/assets/) - [liquidation](https://schoolworkhelper.net/tag/liquidation/) - [foreseeable liabilities](https://schoolworkhelper.net/tag/foreseeable-liabilities/) - [unquantified damage](https://schoolworkhelper.net/tag/unquantified-damage/) - [litigation](https://schoolworkhelper.net/tag/litigation/) - [Google](https://schoolworkhelper.net/tag/google/) - [Baidu](https://schoolworkhelper.net/tag/baidu/) - [AOL](https://schoolworkhelper.net/tag/aol/) - [Orion](https://schoolworkhelper.net/tag/orion/) - [Youtube](https://schoolworkhelper.net/tag/youtube/) - [All the web](https://schoolworkhelper.net/tag/all-the-web/) - [Ask Jeeves](https://schoolworkhelper.net/tag/ask-jeeves/) - [America Online Inc. (AOL)](https://schoolworkhelper.net/tag/america-online-inc-aol/) - [Time Warner](https://schoolworkhelper.net/tag/time-warner/) - [Royal Dutch Petroleum Co. Shell Transport & Trading Co](https://schoolworkhelper.net/tag/royal-dutch-petroleum-co-shell-transport-trading-co/) - [AT&T Inc.](https://schoolworkhelper.net/tag/att-inc/) - [BellSouth Corporation](https://schoolworkhelper.net/tag/bellsouth-corporation/) - [Comcast Corporation](https://schoolworkhelper.net/tag/comcast-corporation/) - [AT&T Broadband & Internet Svcs Corporation](https://schoolworkhelper.net/tag/att-broadband-internet-svcs-corporation/) - [JP Morgan Chase & Co](https://schoolworkhelper.net/tag/jp-morgan-chase-co/) - [Bank One Corp](https://schoolworkhelper.net/tag/bank-one-corp/) - [Atonement the Movie](https://schoolworkhelper.net/tag/atonement-the-movie/) - [Parallelism](https://schoolworkhelper.net/tag/parallelism/) - [Robbie](https://schoolworkhelper.net/tag/robbie/) - [World War II](https://schoolworkhelper.net/tag/world-war-ii/) - [Paradox](https://schoolworkhelper.net/tag/paradox/) - [Briony](https://schoolworkhelper.net/tag/briony/) - [Foreshadow](https://schoolworkhelper.net/tag/foreshadow/) - [social injustice](https://schoolworkhelper.net/tag/social-injustice/) - [Lola](https://schoolworkhelper.net/tag/lola/) - [Paul Marshall](https://schoolworkhelper.net/tag/paul-marshall/) - [Cecilia](https://schoolworkhelper.net/tag/cecilia/) - [Literary devices](https://schoolworkhelper.net/tag/literary-devices/) - [penny-pinching school boards](https://schoolworkhelper.net/tag/penny-pinching-school-boards/) - [The Role of the Teacher](https://schoolworkhelper.net/tag/the-role-of-the-teacher/) - [teachers](https://schoolworkhelper.net/tag/teachers/) - [Mr. Layton](https://schoolworkhelper.net/tag/mr-layton/) - [harmony](https://schoolworkhelper.net/tag/harmony/) - [wisdom](https://schoolworkhelper.net/tag/wisdom/) - [pupil](https://schoolworkhelper.net/tag/pupil/) - [passions](https://schoolworkhelper.net/tag/passions/) - [socially responsible citizens](https://schoolworkhelper.net/tag/socially-responsible-citizens/) - [academic proficiency](https://schoolworkhelper.net/tag/academic-proficiency/) - [time management](https://schoolworkhelper.net/tag/time-management/) - [schools](https://schoolworkhelper.net/tag/schools/) - [universities](https://schoolworkhelper.net/tag/universities/) - [well rounded individuals](https://schoolworkhelper.net/tag/well-rounded-individuals/) - [self-improvement](https://schoolworkhelper.net/tag/self-improvement/) - [INTRODUCTION](https://schoolworkhelper.net/tag/introduction/) - [Thesis](https://schoolworkhelper.net/tag/thesis/) - [Running Water](https://schoolworkhelper.net/tag/running-water/) - [Translation](https://schoolworkhelper.net/tag/translation/) - [Iago](https://schoolworkhelper.net/tag/iago/) - [Othello](https://schoolworkhelper.net/tag/othello/) - [Cyprus](https://schoolworkhelper.net/tag/cyprus/) - [Haber Process](https://schoolworkhelper.net/tag/haber-process/) - [how haber process works](https://schoolworkhelper.net/tag/how-haber-process-works/) - [ammonia](https://schoolworkhelper.net/tag/ammonia/) - [equilibrium system](https://schoolworkhelper.net/tag/equilibrium-system/) - [Le Chatelier's Principle](https://schoolworkhelper.net/tag/le-chateliers-principle/) - [N2 or H2](https://schoolworkhelper.net/tag/n2-or-h2/) - [catalyst](https://schoolworkhelper.net/tag/catalyst/) - [high temperatures](https://schoolworkhelper.net/tag/high-temperatures/) - [iron oxide](https://schoolworkhelper.net/tag/iron-oxide/) - [activation energy](https://schoolworkhelper.net/tag/activation-energy/) - [Nitroglycerin](https://schoolworkhelper.net/tag/nitroglycerin/) - [Trinitrotoluene](https://schoolworkhelper.net/tag/trinitrotoluene/) - [TNT](https://schoolworkhelper.net/tag/tnt/) - [Nitrocellulose](https://schoolworkhelper.net/tag/nitrocellulose/) - [Guncotton](https://schoolworkhelper.net/tag/guncotton/) - [Semtex](https://schoolworkhelper.net/tag/semtex/) - [Nitro Plastic Explosive](https://schoolworkhelper.net/tag/nitro-plastic-explosive/) - [highly flammable](https://schoolworkhelper.net/tag/highly-flammable/) - [Azotobacter](https://schoolworkhelper.net/tag/azotobacter/) - [Beijerinckia](https://schoolworkhelper.net/tag/beijerinckia/) - [Clostridium](https://schoolworkhelper.net/tag/clostridium/) - [nitrogenase](https://schoolworkhelper.net/tag/nitrogenase/) - [nitrates](https://schoolworkhelper.net/tag/nitrates/) - [or nitrites](https://schoolworkhelper.net/tag/or-nitrites/) - [movie summary](https://schoolworkhelper.net/tag/movie-summary/) - [Oishi Kazihiro](https://schoolworkhelper.net/tag/oishi-kazihiro/) - [Japanese](https://schoolworkhelper.net/tag/japanese/) - [Michael Keaton](https://schoolworkhelper.net/tag/michael-keaton/) - [Hadleyville](https://schoolworkhelper.net/tag/hadleyville/) - [Pennsylvania](https://schoolworkhelper.net/tag/pennsylvania/) - [Assan Motors Corporation](https://schoolworkhelper.net/tag/assan-motors-corporation/) - [North American](https://schoolworkhelper.net/tag/north-american/) - [Car Plant](https://schoolworkhelper.net/tag/car-plant/) - [Song of Solomon Essay](https://schoolworkhelper.net/tag/song-of-solomon-essay/) - [Song of Solomon Essay help](https://schoolworkhelper.net/tag/song-of-solomon-essay-help/) - [Song of Solomon Essay free essay](https://schoolworkhelper.net/tag/song-of-solomon-essay-free-essay/) - [Toni Morrison](https://schoolworkhelper.net/tag/toni-morrison/) - [female characters](https://schoolworkhelper.net/tag/female-characters/) - [heroism](https://schoolworkhelper.net/tag/heroism/) - [Milkman](https://schoolworkhelper.net/tag/milkman/) - [Macon Dead Jr.](https://schoolworkhelper.net/tag/macon-dead-jr/) - [lost gold treasure](https://schoolworkhelper.net/tag/lost-gold-treasure/) - [Bloom](https://schoolworkhelper.net/tag/bloom/) - [sexual dominion](https://schoolworkhelper.net/tag/sexual-dominion/) - [Sweet](https://schoolworkhelper.net/tag/sweet/) - [manhood](https://schoolworkhelper.net/tag/manhood/) - [Pilate](https://schoolworkhelper.net/tag/pilate/) - [Hagar](https://schoolworkhelper.net/tag/hagar/) - [Milkman`s journey](https://schoolworkhelper.net/tag/milkmans-journey/) - [His mother](https://schoolworkhelper.net/tag/his-mother/) - [his twin older sisters](https://schoolworkhelper.net/tag/his-twin-older-sisters/) - [his aunties and cousins](https://schoolworkhelper.net/tag/his-aunties-and-cousins/) - [Macon Dead II](https://schoolworkhelper.net/tag/macon-dead-ii/) - [Ruth](https://schoolworkhelper.net/tag/ruth/) - [Henry Porter](https://schoolworkhelper.net/tag/henry-porter/) - [Lena](https://schoolworkhelper.net/tag/lena/) - [Corinthians](https://schoolworkhelper.net/tag/corinthians/) - [Ryna](https://schoolworkhelper.net/tag/ryna/) - [Pilate Dead](https://schoolworkhelper.net/tag/pilate-dead/) - [1993 Nobel Prize](https://schoolworkhelper.net/tag/1993-nobel-prize/) - [Trading between Canada and Jamaica](https://schoolworkhelper.net/tag/trading-between-canada-and-jamaica/) - [international cooperation](https://schoolworkhelper.net/tag/international-cooperation/) - [bilateral trade](https://schoolworkhelper.net/tag/bilateral-trade/) - [security](https://schoolworkhelper.net/tag/security/) - [defence cooperation](https://schoolworkhelper.net/tag/defence-cooperation/) - [Commonwealth](https://schoolworkhelper.net/tag/commonwealth/) - [the United Nations](https://schoolworkhelper.net/tag/the-united-nations/) - [Organization of American States](https://schoolworkhelper.net/tag/organization-of-american-states/) - [and the Caribbean Community](https://schoolworkhelper.net/tag/and-the-caribbean-community/) - [(CARICOM)](https://schoolworkhelper.net/tag/caricom/) - [Canadian Forces](https://schoolworkhelper.net/tag/canadian-forces/) - [Jamaican Defence Force](https://schoolworkhelper.net/tag/jamaican-defence-force/) - [international partner](https://schoolworkhelper.net/tag/international-partner/) - [Canadian Seasonal Agricultural Workers Program (SAWP)](https://schoolworkhelper.net/tag/canadian-seasonal-agricultural-workers-program-sawp/) - [Canadian International Development Agency (CIDA)](https://schoolworkhelper.net/tag/canadian-international-development-agency-cida/) - [Shakespearean](https://schoolworkhelper.net/tag/shakespearean/) - [betrayal](https://schoolworkhelper.net/tag/betrayal/) - [love](https://schoolworkhelper.net/tag/love/) - [romance](https://schoolworkhelper.net/tag/romance/) - [death](https://schoolworkhelper.net/tag/death/) - [Lab Exercise 6.1.1](https://schoolworkhelper.net/tag/lab-exercise-6-1-1/) - [Determining the Rate of Reaction](https://schoolworkhelper.net/tag/determining-the-rate-of-reaction/) - [Evaluation](https://schoolworkhelper.net/tag/evaluation/) - [Synthesis](https://schoolworkhelper.net/tag/synthesis/) - [Hydrochloric acid](https://schoolworkhelper.net/tag/hydrochloric-acid/) - [Calcium Carbonate](https://schoolworkhelper.net/tag/calcium-carbonate/) - [CaCO3](https://schoolworkhelper.net/tag/caco3/) - [experimental design](https://schoolworkhelper.net/tag/experimental-design/) - [Conductivity](https://schoolworkhelper.net/tag/conductivity/) - [galvanometer](https://schoolworkhelper.net/tag/galvanometer/) - [gas vapours](https://schoolworkhelper.net/tag/gas-vapours/) - [Shakespeare](https://schoolworkhelper.net/tag/shakespeare/) - [race](https://schoolworkhelper.net/tag/race/) - [So how will the world end](https://schoolworkhelper.net/tag/so-how-will-the-world-end/) - [black hole located in the middle of our galaxy](https://schoolworkhelper.net/tag/black-hole-located-in-the-middle-of-our-galaxy/) - [year 2012](https://schoolworkhelper.net/tag/year-2012/) - [Mayan civilization](https://schoolworkhelper.net/tag/mayan-civilization/) - [calendar](https://schoolworkhelper.net/tag/calendar/) - [December 21](https://schoolworkhelper.net/tag/december-21/) - [2012](https://schoolworkhelper.net/tag/2012/) - [flu virus](https://schoolworkhelper.net/tag/flu-virus/) - [asteroid impact](https://schoolworkhelper.net/tag/asteroid-impact/) - [ozone layer](https://schoolworkhelper.net/tag/ozone-layer/) - [reversal of the earth magnetic poles](https://schoolworkhelper.net/tag/reversal-of-the-earth-magnetic-poles/) - [super volcano](https://schoolworkhelper.net/tag/super-volcano/) - [colossal events](https://schoolworkhelper.net/tag/colossal-events/) - [Large Haldron Collider](https://schoolworkhelper.net/tag/large-haldron-collider/) - [Geneva](https://schoolworkhelper.net/tag/geneva/) - [Switzerland](https://schoolworkhelper.net/tag/switzerland/) - [nuclear holocaust](https://schoolworkhelper.net/tag/nuclear-holocaust/) - [Practical uses](https://schoolworkhelper.net/tag/practical-uses/) - [Industrial Uses](https://schoolworkhelper.net/tag/industrial-uses/) - [Alcohols](https://schoolworkhelper.net/tag/alcohols/) - [Ethers](https://schoolworkhelper.net/tag/ethers/) - [ethanol](https://schoolworkhelper.net/tag/ethanol/) - [solvent](https://schoolworkhelper.net/tag/solvent/) - [methylated spirits](https://schoolworkhelper.net/tag/methylated-spirits/) - [isopropyl alcohol](https://schoolworkhelper.net/tag/isopropyl-alcohol/) - [medical drugs](https://schoolworkhelper.net/tag/medical-drugs/) - [perfumes](https://schoolworkhelper.net/tag/perfumes/) - [vegetable essences](https://schoolworkhelper.net/tag/vegetable-essences/) - [olvents for fats](https://schoolworkhelper.net/tag/olvents-for-fats/) - [oils](https://schoolworkhelper.net/tag/oils/) - [waxes](https://schoolworkhelper.net/tag/waxes/) - [resins](https://schoolworkhelper.net/tag/resins/) - [dyes](https://schoolworkhelper.net/tag/dyes/) - [gums](https://schoolworkhelper.net/tag/gums/) - [pharmacology](https://schoolworkhelper.net/tag/pharmacology/) - [medicine](https://schoolworkhelper.net/tag/medicine/) - [anaesthetics](https://schoolworkhelper.net/tag/anaesthetics/) - [Methoxymethane](https://schoolworkhelper.net/tag/methoxymethane/) - [Ethoxyethane](https://schoolworkhelper.net/tag/ethoxyethane/) - [codeine](https://schoolworkhelper.net/tag/codeine/) - [Dimethyl ether](https://schoolworkhelper.net/tag/dimethyl-ether/) - [spray propellant](https://schoolworkhelper.net/tag/spray-propellant/) - [refrigerant](https://schoolworkhelper.net/tag/refrigerant/) - [ethylene glycol](https://schoolworkhelper.net/tag/ethylene-glycol/) - [plasticizers](https://schoolworkhelper.net/tag/plasticizers/) - [Methyl t-butyl ether](https://schoolworkhelper.net/tag/methyl-t-butyl-ether/) - [gasoline stabilizer](https://schoolworkhelper.net/tag/gasoline-stabilizer/) - [Song of Solomon](https://schoolworkhelper.net/tag/song-of-solomon/) - [Song of Solomon Monologue](https://schoolworkhelper.net/tag/song-of-solomon-monologue/) - [1993 Noble Prize](https://schoolworkhelper.net/tag/1993-noble-prize/) - [Ruth Dead](https://schoolworkhelper.net/tag/ruth-dead/) - [First Corinthians](https://schoolworkhelper.net/tag/first-corinthians/) - [Magdalene](https://schoolworkhelper.net/tag/magdalene/) - [Hagar Dead](https://schoolworkhelper.net/tag/hagar-dead/) - [gold](https://schoolworkhelper.net/tag/gold/) - [Guitar Monologue](https://schoolworkhelper.net/tag/guitar-monologue/) - [Virginia](https://schoolworkhelper.net/tag/virginia/) - [Fallacies of Logic](https://schoolworkhelper.net/tag/fallacies-of-logic/) - [Fallacies](https://schoolworkhelper.net/tag/fallacies/) - [Logic](https://schoolworkhelper.net/tag/logic/) - [Fallacy of Accident](https://schoolworkhelper.net/tag/fallacy-of-accident/) - [verbal combatant](https://schoolworkhelper.net/tag/verbal-combatant/) - [pragmatically](https://schoolworkhelper.net/tag/pragmatically/) - [objectively](https://schoolworkhelper.net/tag/objectively/) - [false dilemmas](https://schoolworkhelper.net/tag/false-dilemmas/) - [divine fallacies](https://schoolworkhelper.net/tag/divine-fallacies/) - [non sequiturs](https://schoolworkhelper.net/tag/non-sequiturs/) - [circular thinking](https://schoolworkhelper.net/tag/circular-thinking/) - [straw man defence](https://schoolworkhelper.net/tag/straw-man-defence/) - [red herring fallacies](https://schoolworkhelper.net/tag/red-herring-fallacies/) - [provocative language](https://schoolworkhelper.net/tag/provocative-language/) - [The Five Themes of Geography](https://schoolworkhelper.net/tag/the-five-themes-of-geography/) - [The Five Themes](https://schoolworkhelper.net/tag/the-five-themes/) - [LOCATION](https://schoolworkhelper.net/tag/location/) - [Absolute Location](https://schoolworkhelper.net/tag/absolute-location/) - [address](https://schoolworkhelper.net/tag/address/) - [latitude and longitude](https://schoolworkhelper.net/tag/latitude-and-longitude/) - [Relative Location](https://schoolworkhelper.net/tag/relative-location/) - [PLACE](https://schoolworkhelper.net/tag/place/) - [where we live](https://schoolworkhelper.net/tag/where-we-live/) - [what we eat](https://schoolworkhelper.net/tag/what-we-eat/) - [deforestation](https://schoolworkhelper.net/tag/deforestation/) - [urban sprawl](https://schoolworkhelper.net/tag/urban-sprawl/) - [MOVEMENT](https://schoolworkhelper.net/tag/movement/) - [REGION](https://schoolworkhelper.net/tag/region/) - [HUMAN-ENVIRONMENT INTERACTION](https://schoolworkhelper.net/tag/human-environment-interaction/) - [Types of Stars](https://schoolworkhelper.net/tag/types-of-stars/) - [How stars are formed](https://schoolworkhelper.net/tag/how-stars-are-formed/) - [Stars](https://schoolworkhelper.net/tag/stars/) - [nebulae](https://schoolworkhelper.net/tag/nebulae/) - [protostar](https://schoolworkhelper.net/tag/protostar/) - [supergiants](https://schoolworkhelper.net/tag/supergiants/) - [black dwarf](https://schoolworkhelper.net/tag/black-dwarf/) - [supernova](https://schoolworkhelper.net/tag/supernova/) - [Sun](https://schoolworkhelper.net/tag/sun/) - [neutron star](https://schoolworkhelper.net/tag/neutron-star/) - [neutrons](https://schoolworkhelper.net/tag/neutrons/) - [sequence star](https://schoolworkhelper.net/tag/sequence-star/) - [Red Giants](https://schoolworkhelper.net/tag/red-giants/) - [Betelgeuse in Orion](https://schoolworkhelper.net/tag/betelgeuse-in-orion/) - [White Dwarfs](https://schoolworkhelper.net/tag/white-dwarfs/) - [Brown Dwarfs](https://schoolworkhelper.net/tag/brown-dwarfs/) - [Variable Stars](https://schoolworkhelper.net/tag/variable-stars/) - [Binary Stars](https://schoolworkhelper.net/tag/binary-stars/) - [NEBULA](https://schoolworkhelper.net/tag/nebula/) - [Emission Nebula](https://schoolworkhelper.net/tag/emission-nebula/) - [STAR](https://schoolworkhelper.net/tag/star/) - [SUPERNOVA I](https://schoolworkhelper.net/tag/supernova-i/) - [SUPERNOVA II](https://schoolworkhelper.net/tag/supernova-ii/) - [BLACK HOLES](https://schoolworkhelper.net/tag/black-holes/) - [Sample Chemistry Unit Test](https://schoolworkhelper.net/tag/sample-chemistry-unit-test/) - [Sample](https://schoolworkhelper.net/tag/sample/) - [Unit Test](https://schoolworkhelper.net/tag/unit-test/) - [Thinking and Inquiry](https://schoolworkhelper.net/tag/thinking-and-inquiry/) - [Elements](https://schoolworkhelper.net/tag/elements/) - [Principles of Media Art](https://schoolworkhelper.net/tag/principles-of-media-art/) - [Elements of Media Art](https://schoolworkhelper.net/tag/elements-of-media-art/) - [Light](https://schoolworkhelper.net/tag/light/) - [Time](https://schoolworkhelper.net/tag/time/) - [Point of View](https://schoolworkhelper.net/tag/point-of-view/) - [Performance](https://schoolworkhelper.net/tag/performance/) - [Framing](https://schoolworkhelper.net/tag/framing/) - [Narrative](https://schoolworkhelper.net/tag/narrative/) - [Editing](https://schoolworkhelper.net/tag/editing/) - [Interactivity](https://schoolworkhelper.net/tag/interactivity/) - [Heterogeneity](https://schoolworkhelper.net/tag/heterogeneity/) - [Hybridization](https://schoolworkhelper.net/tag/hybridization/) - [Medium](https://schoolworkhelper.net/tag/medium/) - [Temporality](https://schoolworkhelper.net/tag/temporality/) - [Fundamental](https://schoolworkhelper.net/tag/fundamental/) - [Vocabulary](https://schoolworkhelper.net/tag/vocabulary/) - [for Media Art](https://schoolworkhelper.net/tag/for-media-art/) - [LINE](https://schoolworkhelper.net/tag/line/) - [SHAPE/FORM](https://schoolworkhelper.net/tag/shapeform/) - [TEXTURE](https://schoolworkhelper.net/tag/texture/) - [SPACE](https://schoolworkhelper.net/tag/space/) - [VALUE](https://schoolworkhelper.net/tag/value/) - [COLOUR](https://schoolworkhelper.net/tag/colour/) - [CONTRAST/ VARIETY](https://schoolworkhelper.net/tag/contrast-variety/) - [DOMINANCE/ EMPHASIS](https://schoolworkhelper.net/tag/dominance-emphasis/) - [BALANCE](https://schoolworkhelper.net/tag/balance/) - [RHYTHM/COMPOSITIONAL](https://schoolworkhelper.net/tag/rhythmcompositional/) - [UNITY](https://schoolworkhelper.net/tag/unity/) - [SCALE/ PROPORTION](https://schoolworkhelper.net/tag/scale-proportion/) - [Spaciousness](https://schoolworkhelper.net/tag/spaciousness/) - [Tension](https://schoolworkhelper.net/tag/tension/) - [Crowded](https://schoolworkhelper.net/tag/crowded/) - [Objective Art](https://schoolworkhelper.net/tag/objective-art/) - [Non-objective Art](https://schoolworkhelper.net/tag/non-objective-art/) - [Subject Matter](https://schoolworkhelper.net/tag/subject-matter/) - [Focal Point](https://schoolworkhelper.net/tag/focal-point/) - [2D Space](https://schoolworkhelper.net/tag/2d-space/) - [Positive](https://schoolworkhelper.net/tag/positive/) - [Negative](https://schoolworkhelper.net/tag/negative/) - [What Ended World War One](https://schoolworkhelper.net/tag/what-ended-world-war-one/) - [The Entrance of the United States](https://schoolworkhelper.net/tag/the-entrance-of-the-united-states/) - [ISOLATE](https://schoolworkhelper.net/tag/isolate/) - [WWI](https://schoolworkhelper.net/tag/wwi/) - [EVENTS THAT BROUGHT THE U.S. INTO THE WAR](https://schoolworkhelper.net/tag/events-that-brought-the-u-s-into-the-war/) - [UNRESTRICTED SUBMARINE WARFARE](https://schoolworkhelper.net/tag/unrestricted-submarine-warfare/) - [LUSITANIA](https://schoolworkhelper.net/tag/lusitania/) - [SUSSEX](https://schoolworkhelper.net/tag/sussex/) - [SUSSEX PLEDGE](https://schoolworkhelper.net/tag/sussex-pledge/) - [I. THE ZIMMERMAN TELEGRAM](https://schoolworkhelper.net/tag/i-the-zimmerman-telegram/) - [1. The Exit of the Russians](https://schoolworkhelper.net/tag/1-the-exit-of-the-russians/) - [Czar](https://schoolworkhelper.net/tag/czar/) - [Treaty of Brest-Litovsk](https://schoolworkhelper.net/tag/treaty-of-brest-litovsk/) - [Bolshevik](https://schoolworkhelper.net/tag/bolshevik/) - [November 1918](https://schoolworkhelper.net/tag/november-1918/) - [WW1](https://schoolworkhelper.net/tag/ww1/) - [shells](https://schoolworkhelper.net/tag/shells/) - [water](https://schoolworkhelper.net/tag/water/) - [No Man's Land](https://schoolworkhelper.net/tag/no-mans-land/) - [THE “HUNDRED DAYS” OFFENSIVE](https://schoolworkhelper.net/tag/the-“hundred-days”-offensive/) - [World War One](https://schoolworkhelper.net/tag/world-war-one/) - [Germany](https://schoolworkhelper.net/tag/germany/) - [France](https://schoolworkhelper.net/tag/france/) - [Paris](https://schoolworkhelper.net/tag/paris/) - [Ypres](https://schoolworkhelper.net/tag/ypres/) - [the Somme](https://schoolworkhelper.net/tag/the-somme/) - [Passchendaele](https://schoolworkhelper.net/tag/passchendaele/) - [Amiens](https://schoolworkhelper.net/tag/amiens/) - [destroying roads](https://schoolworkhelper.net/tag/destroying-roads/) - [bridges](https://schoolworkhelper.net/tag/bridges/) - [factories](https://schoolworkhelper.net/tag/factories/) - [and towns](https://schoolworkhelper.net/tag/and-towns/) - [General Currie](https://schoolworkhelper.net/tag/general-currie/) - [Hindenberg Line defences](https://schoolworkhelper.net/tag/hindenberg-line-defences/) - [battles at Arras](https://schoolworkhelper.net/tag/battles-at-arras/) - [Cambrai](https://schoolworkhelper.net/tag/cambrai/) - [and Valenciennes](https://schoolworkhelper.net/tag/and-valenciennes/) - [Private George Lawrence](https://schoolworkhelper.net/tag/private-george-lawrence/) - [THE TREATY OF VERSAILLES](https://schoolworkhelper.net/tag/the-treaty-of-versailles/) - [main terms of the Treaty of Versailles](https://schoolworkhelper.net/tag/main-terms-of-the-treaty-of-versailles/) - [The Great War Comes to an End](https://schoolworkhelper.net/tag/the-great-war-comes-to-an-end/) - [1918](https://schoolworkhelper.net/tag/1918/) - [Britain](https://schoolworkhelper.net/tag/britain/) - [Italy](https://schoolworkhelper.net/tag/italy/) - [the United States](https://schoolworkhelper.net/tag/the-united-states/) - [U.S. President](https://schoolworkhelper.net/tag/u-s-president/) - [Woodrow Wilson's](https://schoolworkhelper.net/tag/woodrow-wilsons/) - ["Fourteen Points"](https://schoolworkhelper.net/tag/fourteen-points/) - [Self-determination](https://schoolworkhelper.net/tag/self-determination/) - [Disarmament](https://schoolworkhelper.net/tag/disarmament/) - [League of Nations](https://schoolworkhelper.net/tag/league-of-nations/) - [Lloyd-George](https://schoolworkhelper.net/tag/lloyd-george/) - [Clemenceau](https://schoolworkhelper.net/tag/clemenceau/) - [Wilson](https://schoolworkhelper.net/tag/wilson/) - [Rhineland](https://schoolworkhelper.net/tag/rhineland/) - [Alsace-Lorraine](https://schoolworkhelper.net/tag/alsace-lorraine/) - [Wilson's 14 Points](https://schoolworkhelper.net/tag/wilsons-14-points/) - [$33 billion](https://schoolworkhelper.net/tag/33-billion/) - [Treaty of Saint Germain 1919](https://schoolworkhelper.net/tag/treaty-of-saint-germain-1919/) - [Treaty of Neuilly 1919](https://schoolworkhelper.net/tag/treaty-of-neuilly-1919/) - [Treaty of Trianon 1920](https://schoolworkhelper.net/tag/treaty-of-trianon-1920/) - [Treaty of Sèvres 1920](https://schoolworkhelper.net/tag/treaty-of-sevres-1920/) - [Article 231](https://schoolworkhelper.net/tag/article-231/) - [The “War Guilt Clause”](https://schoolworkhelper.net/tag/the-“war-guilt-clause”/) - [Theatres of WWI](https://schoolworkhelper.net/tag/theatres-of-wwi/) - [The Western Front](https://schoolworkhelper.net/tag/the-western-front/) - [Austria-Hungary](https://schoolworkhelper.net/tag/austria-hungary/) - [Australia](https://schoolworkhelper.net/tag/australia/) - [New Zealand](https://schoolworkhelper.net/tag/new-zealand/) - [The War at Sea](https://schoolworkhelper.net/tag/the-war-at-sea/) - [THE CONSCRIPTION CRISIS OF 1917](https://schoolworkhelper.net/tag/the-conscription-crisis-of-1917/) - [Prime Minister Borden](https://schoolworkhelper.net/tag/prime-minister-borden/) - [CONSCRIPTION](https://schoolworkhelper.net/tag/conscription/) - [MILITARY SERVICE ACT](https://schoolworkhelper.net/tag/military-service-act/) - [Kaiser](https://schoolworkhelper.net/tag/kaiser/) - [December 1917](https://schoolworkhelper.net/tag/december-1917/) - [How to Write a Formal Laboratory Report](https://schoolworkhelper.net/tag/how-to-write-a-formal-laboratory-report/) - [How to Write](https://schoolworkhelper.net/tag/how-to-write/) - [Formal Laboratory Report](https://schoolworkhelper.net/tag/formal-laboratory-report/) - [TITLE PAGE](https://schoolworkhelper.net/tag/title-page/) - [WRITING UP THE EXPERIMENT](https://schoolworkhelper.net/tag/writing-up-the-experiment/) - [PURPOSE](https://schoolworkhelper.net/tag/purpose/) - [HYPOTHESIS](https://schoolworkhelper.net/tag/hypothesis/) - [APPARATUS](https://schoolworkhelper.net/tag/apparatus/) - [OBSERVATIONS / RESULTS](https://schoolworkhelper.net/tag/observations-results/) - [DISCUSSIONS](https://schoolworkhelper.net/tag/discussions/) - [CONCLUSIONS](https://schoolworkhelper.net/tag/conclusions/) - [House of Commons](https://schoolworkhelper.net/tag/house-of-commons/) - [Members of Parliament](https://schoolworkhelper.net/tag/members-of-parliament/) - [National Court](https://schoolworkhelper.net/tag/national-court/) - [Government Branches](https://schoolworkhelper.net/tag/government-branches/) - [Checks and Balances](https://schoolworkhelper.net/tag/checks-and-balances/) - [Executive](https://schoolworkhelper.net/tag/executive/) - [Legislative](https://schoolworkhelper.net/tag/legislative/) - [Judicial](https://schoolworkhelper.net/tag/judicial/) - [Nominating the Speaker of the House](https://schoolworkhelper.net/tag/nominating-the-speaker-of-the-house/) - [Roles of the Speaker of the House](https://schoolworkhelper.net/tag/roles-of-the-speaker-of-the-house/) - [Nominating a National Judge](https://schoolworkhelper.net/tag/nominating-a-national-judge/) - [PM](https://schoolworkhelper.net/tag/pm/) - [FACTORS](https://schoolworkhelper.net/tag/factors/) - [AFFECT RATES OF REACTION](https://schoolworkhelper.net/tag/affect-rates-of-reaction/) - [Kinetic Molecular Theory](https://schoolworkhelper.net/tag/kinetic-molecular-theory/) - [COLLISION MODEL](https://schoolworkhelper.net/tag/collision-model/) - [TEMPERATURE](https://schoolworkhelper.net/tag/temperature/) - [CONCENTRATION](https://schoolworkhelper.net/tag/concentration/) - [SURFACE AREA](https://schoolworkhelper.net/tag/surface-area/) - [CATALYSTS](https://schoolworkhelper.net/tag/catalysts/) - [EXOTHERMIC AND ENDOTHERMIC CHANGES](https://schoolworkhelper.net/tag/exothermic-and-endothermic-changes/) - [Exothermic Change](https://schoolworkhelper.net/tag/exothermic-change/) - [Endothermic Change](https://schoolworkhelper.net/tag/endothermic-change/) - [ACIDS AND BASES](https://schoolworkhelper.net/tag/acids-and-bases/) - [ACID](https://schoolworkhelper.net/tag/acid/) - [BASE](https://schoolworkhelper.net/tag/base/) - [INDICATOR](https://schoolworkhelper.net/tag/indicator/) - [PROPERTIES OF ACIDS](https://schoolworkhelper.net/tag/properties-of-acids/) - [PROPERTIES OF BASES](https://schoolworkhelper.net/tag/properties-of-bases/) - [Of Mice and Men](https://schoolworkhelper.net/tag/of-mice-and-men/) - [Background Information](https://schoolworkhelper.net/tag/background-information/) - [George](https://schoolworkhelper.net/tag/george/) - [Lennie](https://schoolworkhelper.net/tag/lennie/) - [Setting](https://schoolworkhelper.net/tag/setting/) - [Characters](https://schoolworkhelper.net/tag/characters/) - [Steinbeck’s novel](https://schoolworkhelper.net/tag/steinbeck’s-novel/) - [The spread of Imperialism](https://schoolworkhelper.net/tag/the-spread-of-imperialism/) - [1880- 1914](https://schoolworkhelper.net/tag/1880-1914/) - [European](https://schoolworkhelper.net/tag/european/) - [USA](https://schoolworkhelper.net/tag/usa/) - [Ottoman](https://schoolworkhelper.net/tag/ottoman/) - [Chinese empires](https://schoolworkhelper.net/tag/chinese-empires/) - [Marxists](https://schoolworkhelper.net/tag/marxists/) - [patriotic argument](https://schoolworkhelper.net/tag/patriotic-argument/) - [colonialism](https://schoolworkhelper.net/tag/colonialism/) - [Louis XIV](https://schoolworkhelper.net/tag/louis-xiv/) - [Cardinal Richelieu](https://schoolworkhelper.net/tag/cardinal-richelieu/) - [("L'état](https://schoolworkhelper.net/tag/letat/) - [c'est moi")](https://schoolworkhelper.net/tag/cest-moi/) - [roi du soleil](https://schoolworkhelper.net/tag/roi-du-soleil/) - [sun king](https://schoolworkhelper.net/tag/sun-king/) - [Mazarin](https://schoolworkhelper.net/tag/mazarin/) - [Nobles](https://schoolworkhelper.net/tag/nobles/) - [Parisian bourgeoisie](https://schoolworkhelper.net/tag/parisian-bourgeoisie/) - [Fountainbleau](https://schoolworkhelper.net/tag/fountainbleau/) - [The Parlement of Paris](https://schoolworkhelper.net/tag/the-parlement-of-paris/) - [Colbert](https://schoolworkhelper.net/tag/colbert/) - [War of Devolution](https://schoolworkhelper.net/tag/war-of-devolution/) - [Aix-la-Chapelle](https://schoolworkhelper.net/tag/aix-la-chapelle/) - [Marquise de Montespan](https://schoolworkhelper.net/tag/marquise-de-montespan/) - [Mme de La Vallière](https://schoolworkhelper.net/tag/mme-de-la-valliere/) - [League of Augsberg](https://schoolworkhelper.net/tag/league-of-augsberg/) - [England](https://schoolworkhelper.net/tag/england/) - [Holland](https://schoolworkhelper.net/tag/holland/) - [Savoy](https://schoolworkhelper.net/tag/savoy/) - [Brandenburg-Prussia](https://schoolworkhelper.net/tag/brandenburg-prussia/) - [Hannover](https://schoolworkhelper.net/tag/hannover/) - [the Palatinate](https://schoolworkhelper.net/tag/the-palatinate/) - [Portugal](https://schoolworkhelper.net/tag/portugal/) - [Utrecht](https://schoolworkhelper.net/tag/utrecht/) - [Rastatt](https://schoolworkhelper.net/tag/rastatt/) - [Baden](https://schoolworkhelper.net/tag/baden/) - [Grand Dauphin](https://schoolworkhelper.net/tag/grand-dauphin/) - [Bourgogne and Berry](https://schoolworkhelper.net/tag/bourgogne-and-berry/) - [Duc de Bretagne](https://schoolworkhelper.net/tag/duc-de-bretagne/) - [Duc du Maine](https://schoolworkhelper.net/tag/duc-du-maine/) - [his son by Mme de Montespan](https://schoolworkhelper.net/tag/his-son-by-mme-de-montespan/) - [How to submit work to turnitin.com](https://schoolworkhelper.net/tag/how-to-submit-work-to-turnitin-com/) - [submit work](https://schoolworkhelper.net/tag/submit-work/) - [turnitin.com](https://schoolworkhelper.net/tag/turnitin-com/) - [Criminal Law](https://schoolworkhelper.net/tag/criminal-law/) - [the Process](https://schoolworkhelper.net/tag/the-process/) - [mens rea](https://schoolworkhelper.net/tag/mens-rea/) - [THE LEVELS OF POLICE IN CANADA](https://schoolworkhelper.net/tag/the-levels-of-police-in-canada/) - [Federal – RCMP – responsible for all federal law under the Criminal Code and federal regulation](https://schoolworkhelper.net/tag/federal-–-rcmp-–-responsible-for-all-federal-law-under-the-criminal-code-and-federal-regulation/) - [Provincial Police](https://schoolworkhelper.net/tag/provincial-police/) - [Municipal Police](https://schoolworkhelper.net/tag/municipal-police/) - [Aboriginal Police](https://schoolworkhelper.net/tag/aboriginal-police/) - [The perpetrator](https://schoolworkhelper.net/tag/the-perpetrator/) - [Parties to the offence](https://schoolworkhelper.net/tag/parties-to-the-offence/) - [Aiding](https://schoolworkhelper.net/tag/aiding/) - [Abetting Counselling](https://schoolworkhelper.net/tag/abetting-counselling/) - [Accessory after the fact](https://schoolworkhelper.net/tag/accessory-after-the-fact/) - [Party to common intention](https://schoolworkhelper.net/tag/party-to-common-intention/) - [Patrol Officer](https://schoolworkhelper.net/tag/patrol-officer/) - [Crime Officer](https://schoolworkhelper.net/tag/crime-officer/) - [Criminal Identification Officer](https://schoolworkhelper.net/tag/criminal-identification-officer/) - [Criminal Investigations Bureau Officer](https://schoolworkhelper.net/tag/criminal-investigations-bureau-officer/) - [Inward spiral](https://schoolworkhelper.net/tag/inward-spiral/) - [Outward spiral](https://schoolworkhelper.net/tag/outward-spiral/) - [Parallel](https://schoolworkhelper.net/tag/parallel/) - [Grid zone](https://schoolworkhelper.net/tag/grid-zone/) - [ARREST](https://schoolworkhelper.net/tag/arrest/) - [APPEARANCE NOTICE](https://schoolworkhelper.net/tag/appearance-notice/) - [ARREST WARRANT](https://schoolworkhelper.net/tag/arrest-warrant/) - [SUMMONS](https://schoolworkhelper.net/tag/summons/) - [an INFORMATION](https://schoolworkhelper.net/tag/an-information/) - [WITHOUT A WARRANT](https://schoolworkhelper.net/tag/without-a-warrant/) - [ARREST LAWFUL](https://schoolworkhelper.net/tag/arrest-lawful/) - [RESISTS ARREST](https://schoolworkhelper.net/tag/resists-arrest/) - [PRE TRIAL PROCEDURES](https://schoolworkhelper.net/tag/pre-trial-procedures/) - [FULL DISCLOSURE](https://schoolworkhelper.net/tag/full-disclosure/) - [PRE-TRIAL RELEASE](https://schoolworkhelper.net/tag/pre-trial-release/) - [RECOGNIZANCE](https://schoolworkhelper.net/tag/recognizance/) - [BAIL](https://schoolworkhelper.net/tag/bail/) - [TRIAL PROCEDURES](https://schoolworkhelper.net/tag/trial-procedures/) - [THE ROLE OF THE JURY](https://schoolworkhelper.net/tag/the-role-of-the-jury/) - [EMPANELLING](https://schoolworkhelper.net/tag/empanelling/) - [JURY DUTY](https://schoolworkhelper.net/tag/jury-duty/) - [Ancient Israel](https://schoolworkhelper.net/tag/ancient-israel/) - [Judaism](https://schoolworkhelper.net/tag/judaism/) - [Christianity and Islam](https://schoolworkhelper.net/tag/christianity-and-islam/) - [Abraham](https://schoolworkhelper.net/tag/abraham/) - [Jacob](https://schoolworkhelper.net/tag/jacob/) - [Moses](https://schoolworkhelper.net/tag/moses/) - [Joshuam](https://schoolworkhelper.net/tag/joshuam/) - [Jews](https://schoolworkhelper.net/tag/jews/) - [Semites](https://schoolworkhelper.net/tag/semites/) - [Babylonian Captivity](https://schoolworkhelper.net/tag/babylonian-captivity/) - [Exodus](https://schoolworkhelper.net/tag/exodus/) - [Diaspora](https://schoolworkhelper.net/tag/diaspora/) - [Spanish Inquisition](https://schoolworkhelper.net/tag/spanish-inquisition/) - [Holocaust](https://schoolworkhelper.net/tag/holocaust/) - [Israelites](https://schoolworkhelper.net/tag/israelites/) - [Nomadic tribes](https://schoolworkhelper.net/tag/nomadic-tribes/) - [Ephrates](https://schoolworkhelper.net/tag/ephrates/) - [Ramses II](https://schoolworkhelper.net/tag/ramses-ii/) - [Jericho](https://schoolworkhelper.net/tag/jericho/) - [Temple of Jerusalem](https://schoolworkhelper.net/tag/temple-of-jerusalem/) - [to house the Arc of the Covenant](https://schoolworkhelper.net/tag/to-house-the-arc-of-the-covenant/) - [Hellenization](https://schoolworkhelper.net/tag/hellenization/) - [concept of Monotheism](https://schoolworkhelper.net/tag/concept-of-monotheism/) - [God](https://schoolworkhelper.net/tag/god/) - [Yahweh](https://schoolworkhelper.net/tag/yahweh/) - [Socio-Political Philosophy](https://schoolworkhelper.net/tag/socio-political-philosophy/) - [Purposes](https://schoolworkhelper.net/tag/purposes/) - [Approaches](https://schoolworkhelper.net/tag/approaches/) - [justice](https://schoolworkhelper.net/tag/justice/) - [freedom](https://schoolworkhelper.net/tag/freedom/) - [authority](https://schoolworkhelper.net/tag/authority/) - [Plato](https://schoolworkhelper.net/tag/plato/) - [Aristotle](https://schoolworkhelper.net/tag/aristotle/) - [The Republic](https://schoolworkhelper.net/tag/the-republic/) - [Politics](https://schoolworkhelper.net/tag/politics/) - [medieval Europe](https://schoolworkhelper.net/tag/medieval-europe/) - [The Renaissance](https://schoolworkhelper.net/tag/the-renaissance/) - [Thomas More](https://schoolworkhelper.net/tag/thomas-more/) - [Niccolo Machiavelli](https://schoolworkhelper.net/tag/niccolo-machiavelli/) - [Enlightenment](https://schoolworkhelper.net/tag/enlightenment/) - [Machiavellian](https://schoolworkhelper.net/tag/machiavellian/) - [Industrial Revolution](https://schoolworkhelper.net/tag/industrial-revolution/) - [ideologies](https://schoolworkhelper.net/tag/ideologies/) - [Communism](https://schoolworkhelper.net/tag/communism/) - [Fascism](https://schoolworkhelper.net/tag/fascism/) - [Cold War](https://schoolworkhelper.net/tag/cold-war/) - [Nationalism](https://schoolworkhelper.net/tag/nationalism/) - [Religious Fundamentalism](https://schoolworkhelper.net/tag/religious-fundamentalism/) - [What is a Thesis?](https://schoolworkhelper.net/tag/what-is-a-thesis/) - [How to make a Good Thesis Statement](https://schoolworkhelper.net/tag/how-to-make-a-good-thesis-statement/) - [Good Thesis Statement](https://schoolworkhelper.net/tag/good-thesis-statement/) - [tentative thesis](https://schoolworkhelper.net/tag/tentative-thesis/) - [Attributes of a good thesis](https://schoolworkhelper.net/tag/attributes-of-a-good-thesis/) - [CELL-MEDIATED IMMUNE RESPONSE](https://schoolworkhelper.net/tag/cell-mediated-immune-response/) - [Complement Protein](https://schoolworkhelper.net/tag/complement-protein/) - [lyse](https://schoolworkhelper.net/tag/lyse/) - [Lymphocytes](https://schoolworkhelper.net/tag/lymphocytes/) - [T-cells](https://schoolworkhelper.net/tag/t-cells/) - [Helper T-cells](https://schoolworkhelper.net/tag/helper-t-cells/) - [Killer T-cells](https://schoolworkhelper.net/tag/killer-t-cells/) - [Suppressor T-cell](https://schoolworkhelper.net/tag/suppressor-t-cell/) - [lymphokine](https://schoolworkhelper.net/tag/lymphokine/) - [Phagocytes](https://schoolworkhelper.net/tag/phagocytes/) - [B-cells](https://schoolworkhelper.net/tag/b-cells/) - [killer T-cell](https://schoolworkhelper.net/tag/killer-t-cell/) - [DPT booster](https://schoolworkhelper.net/tag/dpt-booster/) - [BIOLOGICAL MOLECULES](https://schoolworkhelper.net/tag/biological-molecules/) - [Carbohydrate](https://schoolworkhelper.net/tag/carbohydrate/) - [monosaccharide](https://schoolworkhelper.net/tag/monosaccharide/) - [Triglyceride](https://schoolworkhelper.net/tag/triglyceride/) - [fatty acids](https://schoolworkhelper.net/tag/fatty-acids/) - [glycerol](https://schoolworkhelper.net/tag/glycerol/) - [Protein](https://schoolworkhelper.net/tag/protein/) - [amino acid](https://schoolworkhelper.net/tag/amino-acid/) - [Nucleic Acid](https://schoolworkhelper.net/tag/nucleic-acid/) - [nucleotides](https://schoolworkhelper.net/tag/nucleotides/) - [condensation reaction](https://schoolworkhelper.net/tag/condensation-reaction/) - [hydrolysis](https://schoolworkhelper.net/tag/hydrolysis/) - [Aldose](https://schoolworkhelper.net/tag/aldose/) - [glyceraldehyde](https://schoolworkhelper.net/tag/glyceraldehyde/) - [ribose](https://schoolworkhelper.net/tag/ribose/) - [glucose](https://schoolworkhelper.net/tag/glucose/) - [galactose Ketose](https://schoolworkhelper.net/tag/galactose-ketose/) - [dihydroxyacetone](https://schoolworkhelper.net/tag/dihydroxyacetone/) - [ribulose](https://schoolworkhelper.net/tag/ribulose/) - [fructose](https://schoolworkhelper.net/tag/fructose/) - [dimers](https://schoolworkhelper.net/tag/dimers/) - [glycosidic](https://schoolworkhelper.net/tag/glycosidic/) - [Oligosaccharide](https://schoolworkhelper.net/tag/oligosaccharide/) - [Polysaccharide](https://schoolworkhelper.net/tag/polysaccharide/) - [LIPIDS](https://schoolworkhelper.net/tag/lipids/) - [fats](https://schoolworkhelper.net/tag/fats/) - [phospholipids](https://schoolworkhelper.net/tag/phospholipids/) - [steroids](https://schoolworkhelper.net/tag/steroids/) - [ester linkage](https://schoolworkhelper.net/tag/ester-linkage/) - [hydrophobic](https://schoolworkhelper.net/tag/hydrophobic/) - [How to Name Hydrocarbons](https://schoolworkhelper.net/tag/how-to-name-hydrocarbons/) - [(IUPAC)](https://schoolworkhelper.net/tag/iupac/) - [Alkane](https://schoolworkhelper.net/tag/alkane/) - [Alkene](https://schoolworkhelper.net/tag/alkene/) - [Alkyne](https://schoolworkhelper.net/tag/alkyne/) - [cycloalkane](https://schoolworkhelper.net/tag/cycloalkane/) - [linear](https://schoolworkhelper.net/tag/linear/) - [Prefix](https://schoolworkhelper.net/tag/prefix/) - [Root](https://schoolworkhelper.net/tag/root/) - [Suffix](https://schoolworkhelper.net/tag/suffix/) - [Find the root](https://schoolworkhelper.net/tag/find-the-root/) - [Find the suffix](https://schoolworkhelper.net/tag/find-the-suffix/) - [Give a position to every atom in the main chain](https://schoolworkhelper.net/tag/give-a-position-to-every-atom-in-the-main-chain/) - [double bond](https://schoolworkhelper.net/tag/double-bond/) - [triple bond](https://schoolworkhelper.net/tag/triple-bond/) - [Find the prefix](https://schoolworkhelper.net/tag/find-the-prefix/) - [Put the name together](https://schoolworkhelper.net/tag/put-the-name-together/) - [Valence shell electron pair repulsion (VSEPR) theory](https://schoolworkhelper.net/tag/valence-shell-electron-pair-repulsion-vsepr-theory/) - [VSEPR theory](https://schoolworkhelper.net/tag/vsepr-theory/) - [molecules](https://schoolworkhelper.net/tag/molecules/) - [electrostatic repulsion](https://schoolworkhelper.net/tag/electrostatic-repulsion/) - [valence](https://schoolworkhelper.net/tag/valence/) - [electron pairs](https://schoolworkhelper.net/tag/electron-pairs/) - [steric number](https://schoolworkhelper.net/tag/steric-number/) - [AXE method](https://schoolworkhelper.net/tag/axe-method/) - [sigma bonds](https://schoolworkhelper.net/tag/sigma-bonds/) - [ORGANIC REACTIONS](https://schoolworkhelper.net/tag/organic-reactions/) - [Combustion REACTIONS](https://schoolworkhelper.net/tag/combustion-reactions/) - [Substitution REACTIONS](https://schoolworkhelper.net/tag/substitution-reactions/) - [Addition REACTIONS](https://schoolworkhelper.net/tag/addition-reactions/) - [Elimination REACTIONS](https://schoolworkhelper.net/tag/elimination-reactions/) - [Oxidation REACTIONS](https://schoolworkhelper.net/tag/oxidation-reactions/) - [Reduction REACTIONS](https://schoolworkhelper.net/tag/reduction-reactions/) - [Condensation REACTIONS (dehydration synthesis)](https://schoolworkhelper.net/tag/condensation-reactions-dehydration-synthesis/) - [Hydrolysis REACTIONS (hydration)](https://schoolworkhelper.net/tag/hydrolysis-reactions-hydration/) - [Polymerization REACTIONS](https://schoolworkhelper.net/tag/polymerization-reactions/) - [Reactions of Benzene](https://schoolworkhelper.net/tag/reactions-of-benzene/) - [Proteins in the human body have a wide range of functions which include: Hormones (insulin](https://schoolworkhelper.net/tag/proteins-in-the-human-body-have-a-wide-range-of-functions-which-include-hormones-insulin/) - [testosterone)](https://schoolworkhelper.net/tag/testosterone/) - [Muscle Fibers (actin](https://schoolworkhelper.net/tag/muscle-fibers-actin/) - [muasin)](https://schoolworkhelper.net/tag/muasin/) - [Carrier Protein (Oxygen carrying hemoglobin)](https://schoolworkhelper.net/tag/carrier-protein-oxygen-carrying-hemoglobin/) - [Structure/ Support (nails/ hair)](https://schoolworkhelper.net/tag/structure-support-nails-hair/) - [Enzymes (biological catalyst)](https://schoolworkhelper.net/tag/enzymes-biological-catalyst/) - [Membrane Transport (Na/ K pump)](https://schoolworkhelper.net/tag/membrane-transport-na-k-pump/) - [Cell-to-Cell Recognition](https://schoolworkhelper.net/tag/cell-to-cell-recognition/) - [Primary Structure](https://schoolworkhelper.net/tag/primary-structure/) - [amino terminal](https://schoolworkhelper.net/tag/amino-terminal/) - [carboxyl terminal](https://schoolworkhelper.net/tag/carboxyl-terminal/) - [Secondary Structure](https://schoolworkhelper.net/tag/secondary-structure/) - [α-helix](https://schoolworkhelper.net/tag/α-helix/) - [β-sheet](https://schoolworkhelper.net/tag/β-sheet/) - [Tertiary Structure](https://schoolworkhelper.net/tag/tertiary-structure/) - [Quaternary Structure](https://schoolworkhelper.net/tag/quaternary-structure/) - [Denaturation](https://schoolworkhelper.net/tag/denaturation/) - [Hemoglobin](https://schoolworkhelper.net/tag/hemoglobin/) - [Allosteric Co-operativity](https://schoolworkhelper.net/tag/allosteric-co-operativity/) - [NUCLEIC ACIDS](https://schoolworkhelper.net/tag/nucleic-acids/) - [ATP](https://schoolworkhelper.net/tag/atp/) - [electron](https://schoolworkhelper.net/tag/electron/) - [NAD+](https://schoolworkhelper.net/tag/nad/) - [dinucleotide](https://schoolworkhelper.net/tag/dinucleotide/) - [FAD](https://schoolworkhelper.net/tag/fad/) - [flavin](https://schoolworkhelper.net/tag/flavin/) - [cAMP](https://schoolworkhelper.net/tag/camp/) - [monophosphate](https://schoolworkhelper.net/tag/monophosphate/) - [anti-parallel](https://schoolworkhelper.net/tag/anti-parallel/) - [DNA](https://schoolworkhelper.net/tag/dna/) - [Deoxyribonucleic Acid](https://schoolworkhelper.net/tag/deoxyribonucleic-acid/) - [hydrogen bonding](https://schoolworkhelper.net/tag/hydrogen-bonding/) - [Adenine](https://schoolworkhelper.net/tag/adenine/) - [Thymine](https://schoolworkhelper.net/tag/thymine/) - [Guanine](https://schoolworkhelper.net/tag/guanine/) - [Cytosine](https://schoolworkhelper.net/tag/cytosine/) - [Ribonucleic Acid](https://schoolworkhelper.net/tag/ribonucleic-acid/) - [Uracil](https://schoolworkhelper.net/tag/uracil/) - [transcription](https://schoolworkhelper.net/tag/transcription/) - [ribosomes](https://schoolworkhelper.net/tag/ribosomes/) - [polypeptide](https://schoolworkhelper.net/tag/polypeptide/) - [mRNA](https://schoolworkhelper.net/tag/mrna/) - [rRNA](https://schoolworkhelper.net/tag/rrna/) - [tRNA](https://schoolworkhelper.net/tag/trna/) - [MacKenzie King](https://schoolworkhelper.net/tag/mackenzie-king/) - [Newfoundland](https://schoolworkhelper.net/tag/newfoundland/) - [Confederation](https://schoolworkhelper.net/tag/confederation/)