Protein Synthesis Lab Answers
The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…



