Would it be unusual for the mean of a sample of 3 to be 115 or more? Why or why not? Yes, it would be unusual for the mean of a sample of 3 to be 115 or more because the population’s standard deviation is 15, so the mean of a selection of 3 would…
Problem Hypothesis Introduction Chemical reactions can be defined as “a process in which one or more substances, the reactants, are converted to one or more different substances, the products (W1).” The efficiency of a chemical reaction can be measured using its rate of reaction. The rate of reaction represents how many chemical reactions are occurring…
The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…
Table 1 – All Attempted Trials Between The Acid “Unknown B”, And The Base, (NaOh). Trial Initial Burette Volume Reading (mL) Final Burette Volume Reading (mL) Volume Of Base (Titrant) Added (mL) Success Or Fail 1 0.00mL 8.20mL 8.20mL Failed 2 8.20mL 16.15mL 7.95mL Success 3 16.2mL 24.0mL 7.80mL Success 4 32.0mL 39.9mL 7.90mL Success…
Introduction: Bacteria does not have a membrane-bound nucleus and other internal structures (Kara Rogers, 2020), which it, therefore, classifies as a prokaryotic cell. Bacteria reproduce in 2 different ways, binary fission and conjugation. Binary fission is an asexual reproduction method that only involves 1 parent cell and the genes from the parent cell gets passed…
Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…
432 BCE- Empedocles Empedocles was responsible for separating air as a separate substance. In his beliefs air, fire, water, earth mingle and separate under the compulsion of love and strife. 440 BCE- Democritus Democritus’s theory was the first theory to be contributed to the atomic theory. He proposed that the entire world was made up…
1. AIM/ PURPOSE: The aim of this experiment is pretty simple. It is to measure the refractive index of the light while it moves from one medium to another. Depending on the refractive indexes of both mediums, the angle of refraction will be at a greater or lesser angle. The angles are measured from the…
In the realm of science, forensic dentistry is fast expanding its space. Forensic odontology is a specialized field of dentistry that analyses dental evidence in the interest of justice. It has been established as an indispensable science in medico-legal matters and identifying the mutilated, unknown dead person. Various methods have been developed to determine age, sex,…
Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…
Introduction: Acid rain has an acidity of around 4, which is 1000 times more acidic than normal rain. When humans burn fossil fuels, sulphur dioxide (SO2) and nitrogen oxides (NOx) are released into the atmosphere. Those air pollutants react with water, oxygen, and other substances to form airborne sulfuric and nitric acid. Winds may spread…
Most Bacteria are more beneficial to living things than simply causing diseases. Bacteria are single-celled, or simple, organisms that are invisible to the naked eye. Many bacteria are found both inside and outside of organisms, including humans. Bacteria are also found on surfaces and in substances like water, soil, and food, making them key players…
Humans lose hair, sight, teeth, and muscles with age. Hearing is not any different. There are many reasons people lose their hearing ability as they age. Normal wear and tear are one of the reasons people’s hearing abilities decrease with age, damaging, breaking, and wearing out of hair cells. Sometimes the cells just die. The…
Introduction Ernest Rutherford was a New Zealand chemist and physicist. He is known as the father of nuclear physics because of his discovery of the nuclear structure of an atom. This is the discovery that will be explained in this report. This wasn’t his only discovery. He also discovered the concept of radioactive decay (half-lives),…
INTRODUCTION Yeasts are eukaryotic, single-celled microorganisms that belong to the fungal kingdom. When yeasts consume sugar and convert it to energy, they emit carbon dioxide, this is referred to as fermentation. The yeast will be more active and develop faster if there is more sugar present. While sugar and other sweets provide “food” for yeast,…
INTRODUCTION: Bath bombs consist of a wide range of ingredients, including bath salts, food coloring, fragrance, citric acid, sodium carbonate, and other components. Bath bombs ‘fizz’ when water inclines to trigger a reaction between an acid and a base (neutralizing substance). Many bath bombs contain citric acid, and sodium carbonate, which incline to have a…
ENZYMES AND METABOLISM Chemical reaction – a process that changes/transforms one set of chemicals into another. Chemical reactions always involve changes in the chemical bonds that join atoms in compounds. Reactants – elements that begin/enter the chemical reaction Products – elements that are produced by chemical reaction Energy may be either released or absorbed during…
HABITAT AND GEOGRAPHIC RANGE The Sea Nymph can be found all along the Australian coastline from the Exmouth Gulf in the north-west of Australia through to Victoria. The grass usually grows within a depth of 27 metres in the littoral and sublittoral zones (areas close to the shore affected by breaking waves and tidal currents)…
HABITAT AND GEOGRAPHIC RANGE Fur Seals are found all throughout the Southern Ocean around Australia and New Zealand, as well as parts of the Pacific and Indian Ocean coasts and islands in the subantarctic. They prefer rocky or boulder-strewn beaches, often on islands, that are somewhat secluded from humans. They occasionally venture to more vegetated…
Species A Species B Species C 11 21 31 12 21 37 13 22 40 15 18 44 16 18 43 12 25 42 15 27 40 17 29 42 16 20 30 15 26 38 Calculate the Shannon’s Diversity Index along with the Simpson’s Diversity Index for Species A, Species B and Species C…