Protein Synthesis Lab Answers

The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…

Lab Explained: Isotonic Salt Concentration of Celery & Active Transport in Yeast Cells

Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…

Fermentation of Glucose by Yeast: Lab Explained

Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…

Bacteria’s Positive and Negative Impacts on Humans and Animals

Most Bacteria are more beneficial to living things than simply causing diseases. Bacteria are single-celled, or simple, organisms that are invisible to the naked eye. Many bacteria are found both inside and outside of organisms, including humans. Bacteria are also found on surfaces and in substances like water, soil, and food, making them key players…

Inflate a Balloon with Yeast Fermentation Experiment: Lab Explained

INTRODUCTION Yeasts are eukaryotic, single-celled microorganisms that belong to the fungal kingdom. When yeasts consume sugar and convert it to energy, they emit carbon dioxide, this is referred to as fermentation. The yeast will be more active and develop faster if there is more sugar present. While sugar and other sweets provide “food” for yeast,…

The Effect of Temperature on Hydrochloric Acid and Bath Bombs to Produce Carbon Dioxide Lab Answers

INTRODUCTION: Bath bombs consist of a wide range of ingredients, including bath salts, food coloring, fragrance, citric acid, sodium carbonate, and other components. Bath bombs ‘fizz’ when water inclines to trigger a reaction between an acid and a base (neutralizing substance). Many bath bombs contain citric acid, and sodium carbonate, which incline to have a…

Enzymes as a Biological Catalyst

ENZYMES AND METABOLISM Chemical reaction – a process that changes/transforms one set of chemicals into another. Chemical reactions always involve changes in the chemical bonds that join atoms in compounds. Reactants – elements that begin/enter the chemical reaction Products – elements that are produced by chemical reaction Energy may be either released or absorbed during…