Methyl salicylate C6H4 (HO) COOCH3, also known as salicylic acid methyl ester, oil of wintergreen, is a natural product of many species of plants. Methyl salicylate may be used by plants as a pheromone to warn other plants of pathogens such as tobacco mosaic virus. Methyl salicylate is used in deep heating liniments and in…
Hess’s Law is an advantageous concept in thermodynamics which states that regardless of the multiple steps or stages in a reaction, the total enthalpy change for a reaction will always be the total sum of all enthalpy changes. The heat created during a combustion reaction is measured by the enthalpy of combustion per mole of…
Former US President, Barack Obama once said, “We are the first generation to feel the effect of climate change and the last generation who can do something about it.” Since the 19th century, the average global temperature has risen by over 2 degrees Fahrenheit. This number seems small but in reality, this increase in temperature…
Cornstarch: Upon adding 2 mL of cornstarch to the mixture, a visible change was observed. The mixture exhibited a significant increase in volume and took on a snow-like appearance, becoming more puffy. Stirring the mixture with a stirring rod gradually transformed the mixture’s color into a clear opaque white. Sugar: The addition of 2 mL…
Mercury: Venus: Earth: Mars: Jupiter: Saturn: Uranus: Neptune: Bibliography 1815. “10 Interesting Facts About Mars.” Universe Today, 4 Apr. 2016, www.universetoday.com/14853/interesting-facts-about-planet-mars. Choi, Charles. “Planet Mercury: Facts About the Planet Closest to the Sun.” Space.Com, 14 Oct. 2017, www.space.com/36-mercury-the-suns-closest-planetary-neighbor.html. Mars.Nasa.Gov. “Mars Facts.” NASA’s Mars Exploration Program, mars.nasa.gov/all-about-mars/facts Accessed 13 May 2021. Matt Williams “Ten Interesting Facts…
Introduction The universe is built upon chemical reactions. There are simply so many chemical reactions that change how we live, from the nuclear reactions in the Sun, to photosynthesis and digestion. Although every chemical reaction known is important for human survival, there are many types of chemical reactions ranging from nuclear to combustion. A single…
Would it be unusual for the mean of a sample of 3 to be 115 or more? Why or why not? Yes, it would be unusual for the mean of a sample of 3 to be 115 or more because the population’s standard deviation is 15, so the mean of a selection of 3 would…
Introduction Proteins (or polypeptides) are organic macromolecules consisting of amino acid subunits (monomers) that are arranged in a specific order and folded into a specific shape. These monomers of amino acids are arranged in a specific sequence known as the primary structure which is determined by the DNA of the gene coding that protein. Amino…
Problem Hypothesis Introduction Chemical reactions can be defined as “a process in which one or more substances, the reactants, are converted to one or more different substances, the products (W1).” The efficiency of a chemical reaction can be measured using its rate of reaction. The rate of reaction represents how many chemical reactions are occurring…
The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…
Table 1 – All Attempted Trials Between The Acid “Unknown B”, And The Base, (NaOh). Trial Initial Burette Volume Reading (mL) Final Burette Volume Reading (mL) Volume Of Base (Titrant) Added (mL) Success Or Fail 1 0.00mL 8.20mL 8.20mL Failed 2 8.20mL 16.15mL 7.95mL Success 3 16.2mL 24.0mL 7.80mL Success 4 32.0mL 39.9mL 7.90mL Success…
Introduction: Bacteria does not have a membrane-bound nucleus and other internal structures (Kara Rogers, 2020), which it, therefore, classifies as a prokaryotic cell. Bacteria reproduce in 2 different ways, binary fission and conjugation. Binary fission is an asexual reproduction method that only involves 1 parent cell and the genes from the parent cell gets passed…
Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…
432 BCE- Empedocles Empedocles was responsible for separating air as a separate substance. In his beliefs air, fire, water, earth mingle and separate under the compulsion of love and strife. 440 BCE- Democritus Democritus’s theory was the first theory to be contributed to the atomic theory. He proposed that the entire world was made up…
1. AIM/ PURPOSE: The aim of this experiment is pretty simple. It is to measure the refractive index of the light while it moves from one medium to another. Depending on the refractive indexes of both mediums, the angle of refraction will be at a greater or lesser angle. The angles are measured from the…
In the realm of science, forensic dentistry is fast expanding its space. Forensic odontology is a specialized field of dentistry that analyses dental evidence in the interest of justice. It has been established as an indispensable science in medico-legal matters and identifying the mutilated, unknown dead person. Various methods have been developed to determine age, sex,…
Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…
Introduction: Acid rain has an acidity of around 4, which is 1000 times more acidic than normal rain. When humans burn fossil fuels, sulphur dioxide (SO2) and nitrogen oxides (NOx) are released into the atmosphere. Those air pollutants react with water, oxygen, and other substances to form airborne sulfuric and nitric acid. Winds may spread…
Most Bacteria are more beneficial to living things than simply causing diseases. Bacteria are single-celled, or simple, organisms that are invisible to the naked eye. Many bacteria are found both inside and outside of organisms, including humans. Bacteria are also found on surfaces and in substances like water, soil, and food, making them key players…
Humans lose hair, sight, teeth, and muscles with age. Hearing is not any different. There are many reasons people lose their hearing ability as they age. Normal wear and tear are one of the reasons people’s hearing abilities decrease with age, damaging, breaking, and wearing out of hair cells. Sometimes the cells just die. The…