Redox Titration Lab: Explained

Purpose: To calculate the percentage of H2O2 in a bottle of drugstore hydrogen peroxide by titrating with a standardized potassium permanganate solution. Background: Hydrogen peroxide, H2O2, is easily oxidized. It is used in commercial bleaching processes and wastewater treatment plants as an environmentally friendly alternative to chlorine. Dilute solutions of H2O2 are used to bleach…

Interesting Facts about the Planets

Mercury: Venus: Earth: Mars: Jupiter: Saturn: Uranus: Neptune: Bibliography 1815. “10 Interesting Facts About Mars.” Universe Today, 4 Apr. 2016,  www.universetoday.com/14853/interesting-facts-about-planet-mars. Choi, Charles. “Planet Mercury: Facts About the Planet Closest to the Sun.” Space.Com, 14 Oct. 2017,  www.space.com/36-mercury-the-suns-closest-planetary-neighbor.html. Mars.Nasa.Gov. “Mars Facts.” NASA’s Mars Exploration Program,  mars.nasa.gov/all-about-mars/facts Accessed 13 May 2021. Matt Williams “Ten Interesting Facts…

Factors Affecting the Activity of Catalase and Amylase Lab Answers

Introduction Proteins (or polypeptides) are organic macromolecules consisting of amino acid subunits (monomers) that are arranged in a specific order and folded into a specific shape. These monomers of amino acids are arranged in a specific sequence known as the primary structure which is determined by the DNA of the gene coding that protein. Amino…

Protein Synthesis Lab Answers

The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…

Lab Explained: Isotonic Salt Concentration of Celery & Active Transport in Yeast Cells

Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…

Fermentation of Glucose by Yeast: Lab Explained

Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…

Bacteria’s Positive and Negative Impacts on Humans and Animals

Most Bacteria are more beneficial to living things than simply causing diseases. Bacteria are single-celled, or simple, organisms that are invisible to the naked eye. Many bacteria are found both inside and outside of organisms, including humans. Bacteria are also found on surfaces and in substances like water, soil, and food, making them key players…