The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…
Initiation: – Upstream of the gene, RNA polymerase binds to a genes promoter region and unwinds the DNA double helix Elongation: – RNA polymerase starts building an mRNA, using the template strand of the DNA molecule, in the direction of 5’ to3’ – the strand that is not copied is called the coding strand – …
DNA: DNA is the genetic information or blueprint of who and what we are, and how we operate. This genetic information is devoted to the synthesis of proteins, which are essential to our body. Proteins are created from templates of information called genes in our DNA. The Code: – DNA molecules are long polymers of…