Although the play Antigone was written over two thousand years ago, it is frequently staged worldwide because it features themes relevant to a modern audience. The play features elements of human behavior, characteristics, and nature that remain unchanged over time, hence appealing to a contemporary audience because viewers can identify with themes throughout the play.…
Problem Hypothesis Introduction Chemical reactions can be defined as “a process in which one or more substances, the reactants, are converted to one or more different substances, the products (W1).” The efficiency of a chemical reaction can be measured using its rate of reaction. The rate of reaction represents how many chemical reactions are occurring…
The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…
Turning on those closest to us is a form of destructive behaviour as it always ends in devastation and loss of one’s self. Jack advocates for being a leader in the democratic leadership style they started with, but he begins to disagree with it and wants more power in the dictatorship leadership style he creates.…
Table 1 – All Attempted Trials Between The Acid “Unknown B”, And The Base, (NaOh). Trial Initial Burette Volume Reading (mL) Final Burette Volume Reading (mL) Volume Of Base (Titrant) Added (mL) Success Or Fail 1 0.00mL 8.20mL 8.20mL Failed 2 8.20mL 16.15mL 7.95mL Success 3 16.2mL 24.0mL 7.80mL Success 4 32.0mL 39.9mL 7.90mL Success…
Introduction: Bacteria does not have a membrane-bound nucleus and other internal structures (Kara Rogers, 2020), which it, therefore, classifies as a prokaryotic cell. Bacteria reproduce in 2 different ways, binary fission and conjugation. Binary fission is an asexual reproduction method that only involves 1 parent cell and the genes from the parent cell gets passed…
Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…
Indigenous stories share common-sense understandings and moral teachings; they function as spiritual and mental medicine. Storytelling is a widely practiced and celebrated part of Indigenous culture for connecting Indigenous peoples to their culture and spiritual identities. It serves to heal traumas such as cultural genocide, racially motivated hate crimes, various types of substance abuse, and…
In 1789, a revolution swept across the land of Joan of Arc, which began the dechristianization of France. Throughout the revolution, the new revolutionary authorities suppressed the Catholic Church, abolished the Catholic monarchy, nationalized church property, exiled 30,000 priests, and killed hundreds more. When the revolution began, France had gone to war with Britain and…
432 BCE- Empedocles Empedocles was responsible for separating air as a separate substance. In his beliefs air, fire, water, earth mingle and separate under the compulsion of love and strife. 440 BCE- Democritus Democritus’s theory was the first theory to be contributed to the atomic theory. He proposed that the entire world was made up…
Former president John F. Kennedy left a permanent mark on the world we live in, and his time has been reminisced upon by many. One of these many is the influential president Ronald Reagan, who delivered a speech about his views and opinions of Kennedy at his fundraising event on June 24, 1985. Reagan had…
1. AIM/ PURPOSE: The aim of this experiment is pretty simple. It is to measure the refractive index of the light while it moves from one medium to another. Depending on the refractive indexes of both mediums, the angle of refraction will be at a greater or lesser angle. The angles are measured from the…
The Trolley Problem, a thought experiment in which the individual determines the value of human life, deciding whether it is worth sacrificing an individual in order to save 5. In our growing world, a similar problem arises with the innovation of self-driving cars. In the case of an unavoidable accident, who does the car decide…
What exactly is poetry? Poetry is one of the oldest means of remembering and maintaining history. It is very difficult, if not impossible, to give a precise definition of poetry, but this doesn’t necessarily matter as we can have a perfect understanding of what something is without being able to define it. Poetry itself is…
In the realm of science, forensic dentistry is fast expanding its space. Forensic odontology is a specialized field of dentistry that analyses dental evidence in the interest of justice. It has been established as an indispensable science in medico-legal matters and identifying the mutilated, unknown dead person. Various methods have been developed to determine age, sex,…
What was the Night of Long Knives? The Night of Long Knives, also known as the Röhm Putsch, was the purge of the SA leadership and other political opponents from 30 June 1934 to 2 July 1934. It was a turning point for the German government. Hitler launched the Night of Long Knives to consolidate…
Simon Armitage uses imagery that relates to guilt and sorrowfulness to explore grief in the two poems, the Parting shot and Remains. In Parting shot, for example, the soldier has survivor’s guilt which relates to him having grief for his friend who died on the battlefield, he also goes to his dead friend’s funeral, which…
A central problem of politics is how to obtain and hold onto power. The Christian contemporary belief was that true power comes from those who are merciful, peaceful, generous, and tolerant; in other words, a good politician is a good Christian. In contrast, Machiavelli argued that an effective ruler needs to know how to be…
Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…
A movie so influential that a syndrome has been named after it. The Truman syndrome entails those afflicted with the disorder to believe their lives are reality television shows. The Truman show came out in 1998, starring Truman Burbank, the protagonist of the story who is unaware that his everyday life is being televised continuously…