William completed his Bachelor of Science and Master of Arts in 2013. He current serves as a lecturer, tutor and freelance writer. In his spare time, he enjoys reading, walking his dog and parasailing. Article last reviewed: 2022 | St. Rosemary Institution © 2010-2025 | Creative Commons 4.0

Antigone: Sibling Rivalry, Gender Inequality and Democracy

Although the play Antigone was written over two thousand years ago, it is frequently staged worldwide because it features themes relevant to a modern audience. The play features elements of human behavior, characteristics, and nature that remain unchanged over time, hence appealing to a contemporary audience because viewers can identify with themes throughout the play.…

Protein Synthesis Lab Answers

The following are 3 DNA fragments that together contain one gene. Follow the steps below to convert the gene code from DNA into a protein. Fragment A: AATCTACCGAGGCCGTCCGCCGCCATAT Fragment B: TTTGCCCCGGGATTTCCCATCCCAATTGGGG Fragment C: CGCCCCTCAGAAGTTGGTTCAGACGTTGGC Procedure: Analysis: Which fragments were the beginning, middle, and end? Justify. At what point in the process are introns removed? What…

Lab Explained: Isotonic Salt Concentration of Celery & Active Transport in Yeast Cells

Problem: Hypothesis: the congo red dye into the yeast cells which is demonstrated within this experiment through the comparison of boiled yeast cells and unboiled yeast cells. Introduction “Cells are the building blocks of life”, an expression that is often used when teaching biology, as it is undeniably true. Every living organism is composed of…

Essay: Healing Power And Spiritual Benefit Of Storytelling

Indigenous stories share common-sense understandings and moral teachings; they function as spiritual and mental medicine. Storytelling is a widely practiced and celebrated part of Indigenous culture for connecting Indigenous peoples to their culture and spiritual identities. It serves to heal traumas such as cultural genocide, racially motivated hate crimes, various types of substance abuse, and…

1789 French Revolution and Dechristianization of France

In 1789, a revolution swept across the land of Joan of Arc, which began the dechristianization of France. Throughout the revolution, the new revolutionary authorities suppressed the Catholic Church, abolished the Catholic monarchy, nationalized church property, exiled 30,000 priests, and killed hundreds more. When the revolution began, France had gone to war with Britain and…

Fermentation of Glucose by Yeast: Lab Explained

Introduction Glucose → Ethanol + Carbon dioxide In the absence of oxygen, enzymes from microorganisms break down sugars through the chemical process called fermentation. Because they possess distinctive sets of metabolic genes, microorganisms like bacteria and fungi can develop enzymes that can break down various kinds of sugar compounds. Therefore, the flavor of fermented food…